Incidental Mutation 'R4778:Traf7'
ID368106
Institutional Source Beutler Lab
Gene Symbol Traf7
Ensembl Gene ENSMUSG00000052752
Gene NameTNF receptor-associated factor 7
SynonymsRFWD1
MMRRC Submission 042414-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.665) question?
Stock #R4778 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24508562-24527938 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to G at 24510438 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000024958] [ENSMUST00000070777] [ENSMUST00000088464] [ENSMUST00000176086] [ENSMUST00000176178] [ENSMUST00000176237] [ENSMUST00000176324] [ENSMUST00000176353] [ENSMUST00000177154] [ENSMUST00000177193] [ENSMUST00000176652] [ENSMUST00000177401] [ENSMUST00000176668] [ENSMUST00000177405] [ENSMUST00000177025]
Predicted Effect probably benign
Transcript: ENSMUST00000024958
SMART Domains Protein: ENSMUSP00000024958
Gene: ENSMUSG00000033597

DomainStartEndE-ValueType
ANK 48 77 9.93e-5 SMART
ANK 81 110 1.9e-1 SMART
ANK 114 143 1.51e-4 SMART
ANK 147 176 1.15e0 SMART
ANK 188 217 2.6e-8 SMART
ANK 220 249 3.31e-1 SMART
SH3 284 346 3.62e-5 SMART
Pfam:Caskin1-CID 373 421 3e-26 PFAM
SAM 473 539 3.63e-15 SMART
SAM 542 609 5.41e-14 SMART
low complexity region 631 647 N/A INTRINSIC
low complexity region 667 679 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
low complexity region 841 863 N/A INTRINSIC
Pfam:Caskin-Pro-rich 878 966 3e-37 PFAM
low complexity region 1163 1168 N/A INTRINSIC
low complexity region 1190 1216 N/A INTRINSIC
low complexity region 1222 1232 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1315 1333 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
Pfam:Caskin-tail 1369 1431 7.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070777
SMART Domains Protein: ENSMUSP00000069334
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088464
SMART Domains Protein: ENSMUSP00000085812
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
Pfam:zf-TRAF 221 277 3.4e-8 PFAM
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175732
Predicted Effect probably benign
Transcript: ENSMUST00000176086
SMART Domains Protein: ENSMUSP00000135845
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 103 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176178
SMART Domains Protein: ENSMUSP00000134808
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176237
SMART Domains Protein: ENSMUSP00000134946
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 91 124 4.73e-6 SMART
Pfam:zf-TRAF 182 238 8.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176324
Predicted Effect probably benign
Transcript: ENSMUST00000176353
SMART Domains Protein: ENSMUSP00000135267
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176900
Predicted Effect probably benign
Transcript: ENSMUST00000177154
SMART Domains Protein: ENSMUSP00000135874
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
low complexity region 110 118 N/A INTRINSIC
RING 131 164 4.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177193
SMART Domains Protein: ENSMUSP00000135288
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176652
SMART Domains Protein: ENSMUSP00000134759
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177401
Predicted Effect probably benign
Transcript: ENSMUST00000176668
SMART Domains Protein: ENSMUSP00000135586
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177405
SMART Domains Protein: ENSMUSP00000135127
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177502
SMART Domains Protein: ENSMUSP00000134970
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
RING 24 68 4.24e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177025
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor (TNF; see MIM 191160) receptor-associated factors, such as TRAF7, are signal transducers for members of the TNF receptor superfamily (see MIM 191190). TRAFs are composed of an N-terminal cysteine/histidine-rich region containing zinc RING and/or zinc finger motifs; a coiled-coil (leucine zipper) motif; and a homologous region that defines the TRAF family, the TRAF domain, which is involved in self-association and receptor binding.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T C 4: 107,891,998 V64A probably damaging Het
4932438A13Rik T A 3: 36,937,065 M897K possibly damaging Het
Abcc10 T C 17: 46,304,416 N1349S probably damaging Het
AF529169 T A 9: 89,603,102 I81F probably damaging Het
Ahnak T C 19: 9,011,975 V3541A possibly damaging Het
Arhgap33 T A 7: 30,532,093 T156S probably benign Het
Card11 G T 5: 140,883,782 probably null Het
Cdh3 T A 8: 106,543,826 I445N probably damaging Het
Csrp3 T G 7: 48,832,563 K169N probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Erc1 A T 6: 119,797,337 probably null Het
Fat1 T C 8: 45,038,326 V3808A probably benign Het
Fbxw19 T C 9: 109,494,646 D87G probably damaging Het
Gm1123 T C 9: 99,018,507 I99V probably benign Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5045 T A 15: 59,211,403 noncoding transcript Het
Hand1 T C 11: 57,831,623 D55G possibly damaging Het
Lrguk T A 6: 34,056,080 I227K probably damaging Het
Mdn1 C T 4: 32,683,583 R726* probably null Het
Myo16 T A 8: 10,569,694 V1415E probably damaging Het
Myof T C 19: 37,949,563 D901G probably damaging Het
Naip1 A G 13: 100,426,648 Y670H probably damaging Het
Nmd3 T A 3: 69,731,591 Y171* probably null Het
Notch4 C T 17: 34,582,511 A1111V possibly damaging Het
Nphp4 T A 4: 152,556,291 D1038E probably benign Het
Olfr484 A T 7: 108,124,480 I261N possibly damaging Het
Olfr694 A C 7: 106,689,667 S21R probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pcsk6 G A 7: 65,959,145 G252R probably damaging Het
Pole T G 5: 110,330,832 H15Q probably benign Het
Pstpip1 A G 9: 56,128,620 D383G possibly damaging Het
Ptprq T C 10: 107,591,022 T1551A probably benign Het
Rasgrf2 A G 13: 91,983,661 F626L probably damaging Het
Retreg1 C A 15: 25,971,785 N394K possibly damaging Het
Rpp14 T A 14: 8,090,203 D42E probably benign Het
Rrp8 T A 7: 105,737,274 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Snx1 T C 9: 66,101,416 probably benign Het
Stau1 A T 2: 166,963,522 N51K probably benign Het
Tdrd5 T A 1: 156,255,587 D960V probably damaging Het
Tex10 T C 4: 48,436,468 D750G probably damaging Het
Tmem43 T C 6: 91,482,255 V236A probably damaging Het
Tmem89 T C 9: 108,915,375 V112A probably damaging Het
Vmn1r41 A C 6: 89,747,275 K266T probably damaging Het
Vmn2r65 T C 7: 84,943,593 K469E possibly damaging Het
Zfp831 A G 2: 174,646,807 T1092A possibly damaging Het
Zfp981 T A 4: 146,537,655 S346T probably benign Het
Other mutations in Traf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Traf7 APN 17 24510375 unclassified probably benign
IGL01821:Traf7 APN 17 24510499 missense probably damaging 0.99
IGL02263:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02307:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02321:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02323:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02636:Traf7 APN 17 24512990 missense probably benign
R0109:Traf7 UTSW 17 24513926 missense probably benign 0.12
R0109:Traf7 UTSW 17 24513926 missense probably benign 0.12
R0193:Traf7 UTSW 17 24510551 missense probably benign 0.22
R1426:Traf7 UTSW 17 24511681 missense probably damaging 1.00
R1484:Traf7 UTSW 17 24511811 missense possibly damaging 0.86
R1574:Traf7 UTSW 17 24510553 missense probably damaging 1.00
R1574:Traf7 UTSW 17 24510553 missense probably damaging 1.00
R1728:Traf7 UTSW 17 24512379 missense probably damaging 0.98
R1729:Traf7 UTSW 17 24512379 missense probably damaging 0.98
R1784:Traf7 UTSW 17 24512379 missense probably damaging 0.98
R1959:Traf7 UTSW 17 24513281 missense probably damaging 1.00
R1994:Traf7 UTSW 17 24510502 missense probably damaging 0.99
R2484:Traf7 UTSW 17 24511639 missense probably damaging 1.00
R4682:Traf7 UTSW 17 24513374 missense probably damaging 1.00
R4779:Traf7 UTSW 17 24510438 unclassified probably benign
R4781:Traf7 UTSW 17 24510438 unclassified probably benign
R5120:Traf7 UTSW 17 24518744 nonsense probably null
R6594:Traf7 UTSW 17 24509839 missense possibly damaging 0.92
R6885:Traf7 UTSW 17 24512292 missense probably benign 0.28
R7396:Traf7 UTSW 17 24509545 missense probably damaging 1.00
R7669:Traf7 UTSW 17 24513308 nonsense probably null
R7707:Traf7 UTSW 17 24510709 splice site probably null
R8087:Traf7 UTSW 17 24512064 missense possibly damaging 0.69
Z1177:Traf7 UTSW 17 24509572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCACTGTACAGATAGCTC -3'
(R):5'- CACCATCATTGTGAGTGGGC -3'

Sequencing Primer
(F):5'- CTCTGTGCTGCCACCAG -3'
(R):5'- CGAGAAGACCCATTGCTCTTTC -3'
Posted On2015-12-29