Incidental Mutation 'R4779:Zdbf2'
ID 368114
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission 045240-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R4779 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 63312424-63353735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63342397 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 259 (R259G)
Ref Sequence ENSEMBL: ENSMUSP00000109767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect possibly damaging
Transcript: ENSMUST00000029025
AA Change: R259G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: R259G

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083151
Predicted Effect possibly damaging
Transcript: ENSMUST00000114132
AA Change: R259G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: R259G

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,667,613 (GRCm39) S335T unknown Het
4933421I07Rik T A 7: 42,097,455 (GRCm39) H13L possibly damaging Het
6030468B19Rik A G 11: 117,696,834 (GRCm39) T185A probably benign Het
Abcc1 T A 16: 14,228,635 (GRCm39) V294E probably benign Het
Abhd16b A G 2: 181,135,253 (GRCm39) T52A possibly damaging Het
Actl7a A T 4: 56,743,632 (GRCm39) N53I probably benign Het
Ankmy1 T C 1: 92,814,445 (GRCm39) E354G probably benign Het
Arap1 T C 7: 101,053,574 (GRCm39) F1301S probably damaging Het
Arfgef1 A T 1: 10,223,958 (GRCm39) W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 62,936,187 (GRCm39) probably benign Het
Ccl24 T A 5: 135,601,811 (GRCm39) T6S possibly damaging Het
Cep152 G T 2: 125,410,812 (GRCm39) P1292Q possibly damaging Het
Cfap46 T C 7: 139,239,731 (GRCm39) probably benign Het
Chd6 A T 2: 160,791,477 (GRCm39) S2627T probably damaging Het
Chd8 A T 14: 52,468,963 (GRCm39) S552T probably damaging Het
Ciita C A 16: 10,329,230 (GRCm39) L502M probably damaging Het
Clic1 T C 17: 35,271,463 (GRCm39) F31S probably damaging Het
Cntnap1 T A 11: 101,068,898 (GRCm39) I147N possibly damaging Het
Cplane1 T C 15: 8,248,322 (GRCm39) S1624P probably benign Het
Crispld1 T A 1: 17,819,831 (GRCm39) D276E probably benign Het
Cspg4 A T 9: 56,793,092 (GRCm39) N276Y probably damaging Het
Cspg4b A T 13: 113,504,870 (GRCm39) N2000Y possibly damaging Het
Cwf19l2 A G 9: 3,410,035 (GRCm39) M55V possibly damaging Het
Cyp2c69 T C 19: 39,866,038 (GRCm39) N185S probably benign Het
Dop1b T C 16: 93,553,969 (GRCm39) I301T probably damaging Het
Epg5 T C 18: 78,034,580 (GRCm39) V1443A probably benign Het
Ephb4 T C 5: 137,363,964 (GRCm39) V612A probably benign Het
Fcgbp T A 7: 27,794,362 (GRCm39) C1189S probably damaging Het
Fgfr2 T G 7: 129,786,923 (GRCm39) probably benign Het
Fmn2 A G 1: 174,437,461 (GRCm39) E1144G probably damaging Het
Fmo3 T C 1: 162,796,407 (GRCm39) Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 (GRCm39) T11A probably damaging Het
Ghdc G T 11: 100,660,929 (GRCm39) Q79K possibly damaging Het
Gm11677 C T 11: 111,615,537 (GRCm39) noncoding transcript Het
Gm5591 T C 7: 38,221,680 (GRCm39) T130A probably damaging Het
Heg1 T G 16: 33,540,142 (GRCm39) D367E probably benign Het
Igkv13-84 C T 6: 68,916,894 (GRCm39) P64S probably damaging Het
Il10rb T A 16: 91,211,545 (GRCm39) S128T possibly damaging Het
Il15ra T A 2: 11,723,117 (GRCm39) I47N probably damaging Het
Il33 C A 19: 29,936,311 (GRCm39) S207* probably null Het
Itgb7 A G 15: 102,132,848 (GRCm39) Y155H possibly damaging Het
Kdm5a A G 6: 120,346,060 (GRCm39) probably benign Het
Kif11 G A 19: 37,406,397 (GRCm39) V987I probably benign Het
Krtap19-2 G A 16: 88,670,762 (GRCm39) probably benign Het
Krtap24-1 T A 16: 88,408,417 (GRCm39) R236S probably damaging Het
L3mbtl2 A G 15: 81,566,813 (GRCm39) I406V probably benign Het
Lrp2 A T 2: 69,290,059 (GRCm39) H3593Q possibly damaging Het
Mavs G T 2: 131,082,285 (GRCm39) W56C probably damaging Het
Mn1 C T 5: 111,567,526 (GRCm39) P499S probably damaging Het
Ntn5 T A 7: 45,340,895 (GRCm39) C178S probably damaging Het
Nufip2 A G 11: 77,577,154 (GRCm39) H34R unknown Het
Or5p51 T A 7: 107,444,755 (GRCm39) M62L possibly damaging Het
Or6f2 T A 7: 139,756,363 (GRCm39) L110Q probably damaging Het
Osbpl10 C T 9: 114,938,598 (GRCm39) S86L probably damaging Het
Pitpna T A 11: 75,511,153 (GRCm39) M242K possibly damaging Het
Pnpla6 T C 8: 3,572,838 (GRCm39) V345A probably benign Het
Polk A G 13: 96,632,999 (GRCm39) probably null Het
Polr3k A G 2: 181,506,340 (GRCm39) Y30C probably damaging Het
Pramel6 A G 2: 87,339,941 (GRCm39) H235R probably benign Het
Ptpra G A 2: 130,379,537 (GRCm39) V364I probably damaging Het
Recql A G 6: 142,309,426 (GRCm39) probably benign Het
Ring1 T C 17: 34,241,263 (GRCm39) probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Samsn1 C A 16: 75,744,177 (GRCm39) noncoding transcript Het
Scara5 A G 14: 65,968,198 (GRCm39) H157R probably benign Het
Sdc3 C T 4: 130,546,376 (GRCm39) P245L probably damaging Het
Slc18b1 T A 10: 23,696,767 (GRCm39) M318K possibly damaging Het
Slc26a10 C T 10: 127,009,224 (GRCm39) A638T possibly damaging Het
Slc35f2 T A 9: 53,717,013 (GRCm39) W259R possibly damaging Het
Spata13 G A 14: 60,991,356 (GRCm39) W366* probably null Het
Sptlc3 A G 2: 139,431,509 (GRCm39) T344A probably benign Het
Tap1 T C 17: 34,412,865 (GRCm39) V560A probably damaging Het
Tbc1d1 T C 5: 64,435,389 (GRCm39) probably null Het
Tlr11 A G 14: 50,598,707 (GRCm39) Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 (GRCm39) S230T possibly damaging Het
Tnnt3 C T 7: 142,068,020 (GRCm39) probably benign Het
Traf7 C G 17: 24,729,412 (GRCm39) probably benign Het
Tshz2 A G 2: 169,804,601 (GRCm39) probably benign Het
Tshz3 T C 7: 36,468,397 (GRCm39) S129P probably damaging Het
Ttc6 A T 12: 57,776,237 (GRCm39) N1727I probably damaging Het
Ttc7b A G 12: 100,369,621 (GRCm39) S383P probably damaging Het
Tulp3 T A 6: 128,300,083 (GRCm39) I448F probably damaging Het
Ube3b T C 5: 114,542,778 (GRCm39) probably null Het
Vav1 G A 17: 57,603,552 (GRCm39) V84I probably damaging Het
Vav3 A T 3: 109,416,110 (GRCm39) K243I possibly damaging Het
Vmn1r25 T A 6: 57,956,011 (GRCm39) I93F probably damaging Het
Vmn2r73 C T 7: 85,520,923 (GRCm39) W348* probably null Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63,345,673 (GRCm39) missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63,346,364 (GRCm39) missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63,342,197 (GRCm39) missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63,342,236 (GRCm39) missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63,347,233 (GRCm39) missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0148:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0433:Zdbf2 UTSW 1 63,345,302 (GRCm39) missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63,344,449 (GRCm39) missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63,344,109 (GRCm39) missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63,344,882 (GRCm39) missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63,342,589 (GRCm39) missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63,342,161 (GRCm39) missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63,342,212 (GRCm39) missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63,342,199 (GRCm39) missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63,342,747 (GRCm39) missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63,343,018 (GRCm39) missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63,343,493 (GRCm39) missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63,348,131 (GRCm39) missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63,343,408 (GRCm39) nonsense probably null
R1700:Zdbf2 UTSW 1 63,341,900 (GRCm39) missense unknown
R1720:Zdbf2 UTSW 1 63,342,436 (GRCm39) missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1854:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1973:Zdbf2 UTSW 1 63,348,860 (GRCm39) missense unknown
R2336:Zdbf2 UTSW 1 63,342,623 (GRCm39) missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63,344,774 (GRCm39) missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63,342,224 (GRCm39) missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63,343,364 (GRCm39) missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63,346,636 (GRCm39) missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63,347,579 (GRCm39) missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63,347,830 (GRCm39) missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63,347,483 (GRCm39) missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63,348,940 (GRCm39) missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63,342,020 (GRCm39) missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63,347,951 (GRCm39) missense possibly damaging 0.46
R4928:Zdbf2 UTSW 1 63,347,973 (GRCm39) missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63,342,809 (GRCm39) missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63,344,062 (GRCm39) missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63,343,570 (GRCm39) missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63,347,092 (GRCm39) missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63,344,836 (GRCm39) missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63,345,035 (GRCm39) missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63,345,685 (GRCm39) missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63,319,977 (GRCm39) start gained probably benign
R6245:Zdbf2 UTSW 1 63,343,592 (GRCm39) missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63,346,981 (GRCm39) missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63,342,480 (GRCm39) missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63,346,637 (GRCm39) missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63,344,679 (GRCm39) missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63,343,073 (GRCm39) missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63,343,667 (GRCm39) missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63,343,679 (GRCm39) missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63,347,687 (GRCm39) missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63,348,031 (GRCm39) missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63,329,925 (GRCm39) missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63,345,925 (GRCm39) missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63,346,563 (GRCm39) missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63,346,718 (GRCm39) missense probably benign
R7177:Zdbf2 UTSW 1 63,334,120 (GRCm39) missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63,345,664 (GRCm39) missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63,342,563 (GRCm39) missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63,343,198 (GRCm39) missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63,346,669 (GRCm39) missense probably benign
R7695:Zdbf2 UTSW 1 63,346,529 (GRCm39) missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63,344,530 (GRCm39) missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63,343,264 (GRCm39) missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
R7759:Zdbf2 UTSW 1 63,347,535 (GRCm39) missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63,342,583 (GRCm39) missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63,345,986 (GRCm39) missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63,343,330 (GRCm39) missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63,345,260 (GRCm39) missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63,345,572 (GRCm39) missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63,343,225 (GRCm39) missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63,345,142 (GRCm39) missense probably benign
R8306:Zdbf2 UTSW 1 63,343,234 (GRCm39) missense possibly damaging 0.66
R8309:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63,344,135 (GRCm39) missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63,345,166 (GRCm39) missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63,348,729 (GRCm39) small deletion probably benign
R8528:Zdbf2 UTSW 1 63,342,545 (GRCm39) missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63,347,272 (GRCm39) missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63,347,162 (GRCm39) missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63,346,296 (GRCm39) missense
R9072:Zdbf2 UTSW 1 63,344,923 (GRCm39) missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63,347,168 (GRCm39) missense possibly damaging 0.66
R9257:Zdbf2 UTSW 1 63,345,400 (GRCm39) missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63,343,288 (GRCm39) missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63,344,784 (GRCm39) missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63,342,536 (GRCm39) missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63,342,635 (GRCm39) missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63,341,811 (GRCm39) missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63,344,510 (GRCm39) missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
X0057:Zdbf2 UTSW 1 63,344,549 (GRCm39) missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63,344,696 (GRCm39) missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63,343,404 (GRCm39) missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63,348,362 (GRCm39) missense unknown
Z1177:Zdbf2 UTSW 1 63,343,245 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGGTTAGTACTGGCAGTTGC -3'
(R):5'- CCAAACGTGTTTCTTCTTGGG -3'

Sequencing Primer
(F):5'- ACTGGCAGTTGCTTCAGATTC -3'
(R):5'- TTTGAACGAGATGCCTCACG -3'
Posted On 2015-12-29