Mutagenetix > Incidental Mutation

Incidental Mutation 'R4779:Zdbf2'

368114

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R4779 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 63303238 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 259 (R259G)

Ref Sequence

ENSEMBL: ENSMUSP00000109767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029025
AA Change: R259G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: R259G

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083151

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114132
AA Change: R259G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: R259G

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

98% (95/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,218,838	S1624P	probably benign	Het
4930562C15Rik	T	A	16: 4,849,749	S335T	unknown	Het
4933421I07Rik	T	A	7: 42,448,031	H13L	possibly damaging	Het
6030468B19Rik	A	G	11: 117,806,008	T185A	probably benign	Het
Abcc1	T	A	16: 14,410,771	V294E	probably benign	Het
Abhd16b	A	G	2: 181,493,460	T52A	possibly damaging	Het
Actl7a	A	T	4: 56,743,632	N53I	probably benign	Het
Ankmy1	T	C	1: 92,886,723	E354G	probably benign	Het
Arap1	T	C	7: 101,404,367	F1301S	probably damaging	Het
Arfgef1	A	T	1: 10,153,733	W1447R	probably damaging	Het
Atoh7	ATGGCGCT	AT	10: 63,100,408		probably benign	Het
BC067074	A	T	13: 113,368,336	N2000Y	possibly damaging	Het
Ccl24	T	A	5: 135,572,957	T6S	possibly damaging	Het
Cep152	G	T	2: 125,568,892	P1292Q	possibly damaging	Het
Cfap46	T	C	7: 139,659,815		probably benign	Het
Chd6	A	T	2: 160,949,557	S2627T	probably damaging	Het
Chd8	A	T	14: 52,231,506	S552T	probably damaging	Het
Ciita	C	A	16: 10,511,366	L502M	probably damaging	Het
Clic1	T	C	17: 35,052,487	F31S	probably damaging	Het
Cntnap1	T	A	11: 101,178,072	I147N	possibly damaging	Het
Crispld1	T	A	1: 17,749,607	D276E	probably benign	Het
Cspg4	A	T	9: 56,885,808	N276Y	probably damaging	Het
Cwf19l2	A	G	9: 3,410,035	M55V	possibly damaging	Het
Cyp2c69	T	C	19: 39,877,594	N185S	probably benign	Het
Dopey2	T	C	16: 93,757,081	I301T	probably damaging	Het
Epg5	T	C	18: 77,991,365	V1443A	probably benign	Het
Ephb4	T	C	5: 137,365,702	V612A	probably benign	Het
Fcgbp	T	A	7: 28,094,937	C1189S	probably damaging	Het
Fgfr2	T	G	7: 130,185,193		probably benign	Het
Fmn2	A	G	1: 174,609,895	E1144G	probably damaging	Het
Fmo3	T	C	1: 162,968,838	Y55C	probably damaging	Het
Frmpd1	A	G	4: 45,229,865	T11A	probably damaging	Het
Ghdc	G	T	11: 100,770,103	Q79K	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm5591	T	C	7: 38,522,256	T130A	probably damaging	Het
Heg1	T	G	16: 33,719,772	D367E	probably benign	Het
Igkv13-84	C	T	6: 68,939,910	P64S	probably damaging	Het
Il10rb	T	A	16: 91,414,657	S128T	possibly damaging	Het
Il15ra	T	A	2: 11,718,306	I47N	probably damaging	Het
Il33	C	A	19: 29,958,911	S207*	probably null	Het
Itgb7	A	G	15: 102,224,413	Y155H	possibly damaging	Het
Kdm5a	A	G	6: 120,369,099		probably benign	Het
Kif11	G	A	19: 37,417,949	V987I	probably benign	Het
Krtap19-2	G	A	16: 88,873,874		probably benign	Het
Krtap24-1	T	A	16: 88,611,529	R236S	probably damaging	Het
L3mbtl2	A	G	15: 81,682,612	I406V	probably benign	Het
Lrp2	A	T	2: 69,459,715	H3593Q	possibly damaging	Het
Mavs	G	T	2: 131,240,365	W56C	probably damaging	Het
Mn1	C	T	5: 111,419,660	P499S	probably damaging	Het
Ntn5	T	A	7: 45,691,471	C178S	probably damaging	Het
Nufip2	A	G	11: 77,686,328	H34R	unknown	Het
Olfr470	T	A	7: 107,845,548	M62L	possibly damaging	Het
Olfr523	T	A	7: 140,176,450	L110Q	probably damaging	Het
Osbpl10	C	T	9: 115,109,530	S86L	probably damaging	Het
Pitpna	T	A	11: 75,620,327	M242K	possibly damaging	Het
Pnpla6	T	C	8: 3,522,838	V345A	probably benign	Het
Polk	A	G	13: 96,496,491		probably null	Het
Polr3k	A	G	2: 181,864,547	Y30C	probably damaging	Het
Pramel6	A	G	2: 87,509,597	H235R	probably benign	Het
Ptpra	G	A	2: 130,537,617	V364I	probably damaging	Het
Recql	A	G	6: 142,363,700		probably benign	Het
Ring1	T	C	17: 34,022,289		probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Samsn1	C	A	16: 75,947,289		noncoding transcript	Het
Scara5	A	G	14: 65,730,749	H157R	probably benign	Het
Sdc3	C	T	4: 130,819,065	P245L	probably damaging	Het
Slc18b1	T	A	10: 23,820,869	M318K	possibly damaging	Het
Slc26a10	C	T	10: 127,173,355	A638T	possibly damaging	Het
Slc35f2	T	A	9: 53,809,729	W259R	possibly damaging	Het
Spata13	G	A	14: 60,753,907	W366*	probably null	Het
Sptlc3	A	G	2: 139,589,589	T344A	probably benign	Het
Tap1	T	C	17: 34,193,891	V560A	probably damaging	Het
Tbc1d1	T	C	5: 64,278,046		probably null	Het
Tlr11	A	G	14: 50,361,250	Y231C	possibly damaging	Het
Tmem245	A	T	4: 56,936,468	S230T	possibly damaging	Het
Tnnt3	C	T	7: 142,514,283		probably benign	Het
Traf7	C	G	17: 24,510,438		probably benign	Het
Tshz2	A	G	2: 169,962,681		probably benign	Het
Tshz3	T	C	7: 36,768,972	S129P	probably damaging	Het
Ttc6	A	T	12: 57,729,451	N1727I	probably damaging	Het
Ttc7b	A	G	12: 100,403,362	S383P	probably damaging	Het
Tulp3	T	A	6: 128,323,120	I448F	probably damaging	Het
Ube3b	T	C	5: 114,404,717		probably null	Het
Vav1	G	A	17: 57,296,552	V84I	probably damaging	Het
Vav3	A	T	3: 109,508,794	K243I	possibly damaging	Het
Vmn1r25	T	A	6: 57,979,026	I93F	probably damaging	Het
Vmn2r73	C	T	7: 85,871,715	W348*	probably null	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CGGTTAGTACTGGCAGTTGC -3'
(R):5'- CCAAACGTGTTTCTTCTTGGG -3'

Sequencing Primer
(F):5'- ACTGGCAGTTGCTTCAGATTC -3'
(R):5'- TTTGAACGAGATGCCTCACG -3'

Posted On

2015-12-29