Mutagenetix > Incidental Mutation

Incidental Mutation 'R4779:Chd6'

368126

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.668) question?

Stock #

R4779 (G1)

Quality Score

223

Status

Validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 160949557 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 2627 (S2627T)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000039782
AA Change: S2627T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: S2627T

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Meta Mutation Damage Score

0.0935

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

98% (95/97)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,218,838	S1624P	probably benign	Het
4930562C15Rik	T	A	16: 4,849,749	S335T	unknown	Het
4933421I07Rik	T	A	7: 42,448,031	H13L	possibly damaging	Het
6030468B19Rik	A	G	11: 117,806,008	T185A	probably benign	Het
Abcc1	T	A	16: 14,410,771	V294E	probably benign	Het
Abhd16b	A	G	2: 181,493,460	T52A	possibly damaging	Het
Actl7a	A	T	4: 56,743,632	N53I	probably benign	Het
Ankmy1	T	C	1: 92,886,723	E354G	probably benign	Het
Arap1	T	C	7: 101,404,367	F1301S	probably damaging	Het
Arfgef1	A	T	1: 10,153,733	W1447R	probably damaging	Het
Atoh7	ATGGCGCT	AT	10: 63,100,408		probably benign	Het
BC067074	A	T	13: 113,368,336	N2000Y	possibly damaging	Het
Ccl24	T	A	5: 135,572,957	T6S	possibly damaging	Het
Cep152	G	T	2: 125,568,892	P1292Q	possibly damaging	Het
Cfap46	T	C	7: 139,659,815		probably benign	Het
Chd8	A	T	14: 52,231,506	S552T	probably damaging	Het
Ciita	C	A	16: 10,511,366	L502M	probably damaging	Het
Clic1	T	C	17: 35,052,487	F31S	probably damaging	Het
Cntnap1	T	A	11: 101,178,072	I147N	possibly damaging	Het
Crispld1	T	A	1: 17,749,607	D276E	probably benign	Het
Cspg4	A	T	9: 56,885,808	N276Y	probably damaging	Het
Cwf19l2	A	G	9: 3,410,035	M55V	possibly damaging	Het
Cyp2c69	T	C	19: 39,877,594	N185S	probably benign	Het
Dopey2	T	C	16: 93,757,081	I301T	probably damaging	Het
Epg5	T	C	18: 77,991,365	V1443A	probably benign	Het
Ephb4	T	C	5: 137,365,702	V612A	probably benign	Het
Fcgbp	T	A	7: 28,094,937	C1189S	probably damaging	Het
Fgfr2	T	G	7: 130,185,193		probably benign	Het
Fmn2	A	G	1: 174,609,895	E1144G	probably damaging	Het
Fmo3	T	C	1: 162,968,838	Y55C	probably damaging	Het
Frmpd1	A	G	4: 45,229,865	T11A	probably damaging	Het
Ghdc	G	T	11: 100,770,103	Q79K	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm5591	T	C	7: 38,522,256	T130A	probably damaging	Het
Heg1	T	G	16: 33,719,772	D367E	probably benign	Het
Igkv13-84	C	T	6: 68,939,910	P64S	probably damaging	Het
Il10rb	T	A	16: 91,414,657	S128T	possibly damaging	Het
Il15ra	T	A	2: 11,718,306	I47N	probably damaging	Het
Il33	C	A	19: 29,958,911	S207*	probably null	Het
Itgb7	A	G	15: 102,224,413	Y155H	possibly damaging	Het
Kdm5a	A	G	6: 120,369,099		probably benign	Het
Kif11	G	A	19: 37,417,949	V987I	probably benign	Het
Krtap19-2	G	A	16: 88,873,874		probably benign	Het
Krtap24-1	T	A	16: 88,611,529	R236S	probably damaging	Het
L3mbtl2	A	G	15: 81,682,612	I406V	probably benign	Het
Lrp2	A	T	2: 69,459,715	H3593Q	possibly damaging	Het
Mavs	G	T	2: 131,240,365	W56C	probably damaging	Het
Mn1	C	T	5: 111,419,660	P499S	probably damaging	Het
Ntn5	T	A	7: 45,691,471	C178S	probably damaging	Het
Nufip2	A	G	11: 77,686,328	H34R	unknown	Het
Olfr470	T	A	7: 107,845,548	M62L	possibly damaging	Het
Olfr523	T	A	7: 140,176,450	L110Q	probably damaging	Het
Osbpl10	C	T	9: 115,109,530	S86L	probably damaging	Het
Pitpna	T	A	11: 75,620,327	M242K	possibly damaging	Het
Pnpla6	T	C	8: 3,522,838	V345A	probably benign	Het
Polk	A	G	13: 96,496,491		probably null	Het
Polr3k	A	G	2: 181,864,547	Y30C	probably damaging	Het
Pramel6	A	G	2: 87,509,597	H235R	probably benign	Het
Ptpra	G	A	2: 130,537,617	V364I	probably damaging	Het
Recql	A	G	6: 142,363,700		probably benign	Het
Ring1	T	C	17: 34,022,289		probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Samsn1	C	A	16: 75,947,289		noncoding transcript	Het
Scara5	A	G	14: 65,730,749	H157R	probably benign	Het
Sdc3	C	T	4: 130,819,065	P245L	probably damaging	Het
Slc18b1	T	A	10: 23,820,869	M318K	possibly damaging	Het
Slc26a10	C	T	10: 127,173,355	A638T	possibly damaging	Het
Slc35f2	T	A	9: 53,809,729	W259R	possibly damaging	Het
Spata13	G	A	14: 60,753,907	W366*	probably null	Het
Sptlc3	A	G	2: 139,589,589	T344A	probably benign	Het
Tap1	T	C	17: 34,193,891	V560A	probably damaging	Het
Tbc1d1	T	C	5: 64,278,046		probably null	Het
Tlr11	A	G	14: 50,361,250	Y231C	possibly damaging	Het
Tmem245	A	T	4: 56,936,468	S230T	possibly damaging	Het
Tnnt3	C	T	7: 142,514,283		probably benign	Het
Traf7	C	G	17: 24,510,438		probably benign	Het
Tshz2	A	G	2: 169,962,681		probably benign	Het
Tshz3	T	C	7: 36,768,972	S129P	probably damaging	Het
Ttc6	A	T	12: 57,729,451	N1727I	probably damaging	Het
Ttc7b	A	G	12: 100,403,362	S383P	probably damaging	Het
Tulp3	T	A	6: 128,323,120	I448F	probably damaging	Het
Ube3b	T	C	5: 114,404,717		probably null	Het
Vav1	G	A	17: 57,296,552	V84I	probably damaging	Het
Vav3	A	T	3: 109,508,794	K243I	possibly damaging	Het
Vmn1r25	T	A	6: 57,979,026	I93F	probably damaging	Het
Vmn2r73	C	T	7: 85,871,715	W348*	probably null	Het
Zdbf2	A	G	1: 63,303,238	R259G	possibly damaging	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161052847	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160967880	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3426:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160970183	missense	probably benign
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160949878	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160957079	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6104:Chd6	UTSW	2	161014132	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161013067	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160965730	missense	probably benign
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161013127	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160961279	nonsense	probably null
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161013154	missense	probably damaging	1.00
R7699:Chd6	UTSW	2	161025943	missense	probably benign	0.13
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8261:Chd6	UTSW	2	160957082	missense	probably damaging	1.00
R8317:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8388:Chd6	UTSW	2	161019651	missense	probably damaging	1.00
R8865:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8867:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8996:Chd6	UTSW	2	160981623	missense	probably damaging	1.00
R9091:Chd6	UTSW	2	161029873	nonsense	probably null
R9270:Chd6	UTSW	2	161029873	nonsense	probably null
R9310:Chd6	UTSW	2	161039261	missense	probably damaging	1.00
R9367:Chd6	UTSW	2	161029864	missense	possibly damaging	0.83
R9438:Chd6	UTSW	2	160957158	missense	probably benign	0.01
R9756:Chd6	UTSW	2	160960339	missense	probably benign
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCGGTGCAGTTCTGATCACTG -3'
(R):5'- TCAGCGTCTCTTGCAAGCAC -3'

Sequencing Primer
(F):5'- AGTTCTGATCACTGCCTGGC -3'
(R):5'- AAGTGGTACCTCAGCCACTG -3'

Posted On

2015-12-29