Mutagenetix > Incidental Mutation

Incidental Mutation 'R4779:Ube3b'

368137

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

MMRRC Submission

045240-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4779 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

T to C at 114404717 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000073652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000074002] [ENSMUST00000130169]

AlphaFold

Q9ES34

Predicted Effect

probably null
Transcript: ENSMUST00000074002

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000074002

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130169

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150630

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183408

Predicted Effect

probably benign
Transcript: ENSMUST00000196651

SMART Domains

Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
HECTc	122	495	1.1e-112	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

98% (95/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,218,838	S1624P	probably benign	Het
4930562C15Rik	T	A	16: 4,849,749	S335T	unknown	Het
4933421I07Rik	T	A	7: 42,448,031	H13L	possibly damaging	Het
6030468B19Rik	A	G	11: 117,806,008	T185A	probably benign	Het
Abcc1	T	A	16: 14,410,771	V294E	probably benign	Het
Abhd16b	A	G	2: 181,493,460	T52A	possibly damaging	Het
Actl7a	A	T	4: 56,743,632	N53I	probably benign	Het
Ankmy1	T	C	1: 92,886,723	E354G	probably benign	Het
Arap1	T	C	7: 101,404,367	F1301S	probably damaging	Het
Arfgef1	A	T	1: 10,153,733	W1447R	probably damaging	Het
Atoh7	ATGGCGCT	AT	10: 63,100,408		probably benign	Het
BC067074	A	T	13: 113,368,336	N2000Y	possibly damaging	Het
Ccl24	T	A	5: 135,572,957	T6S	possibly damaging	Het
Cep152	G	T	2: 125,568,892	P1292Q	possibly damaging	Het
Cfap46	T	C	7: 139,659,815		probably benign	Het
Chd6	A	T	2: 160,949,557	S2627T	probably damaging	Het
Chd8	A	T	14: 52,231,506	S552T	probably damaging	Het
Ciita	C	A	16: 10,511,366	L502M	probably damaging	Het
Clic1	T	C	17: 35,052,487	F31S	probably damaging	Het
Cntnap1	T	A	11: 101,178,072	I147N	possibly damaging	Het
Crispld1	T	A	1: 17,749,607	D276E	probably benign	Het
Cspg4	A	T	9: 56,885,808	N276Y	probably damaging	Het
Cwf19l2	A	G	9: 3,410,035	M55V	possibly damaging	Het
Cyp2c69	T	C	19: 39,877,594	N185S	probably benign	Het
Dopey2	T	C	16: 93,757,081	I301T	probably damaging	Het
Epg5	T	C	18: 77,991,365	V1443A	probably benign	Het
Ephb4	T	C	5: 137,365,702	V612A	probably benign	Het
Fcgbp	T	A	7: 28,094,937	C1189S	probably damaging	Het
Fgfr2	T	G	7: 130,185,193		probably benign	Het
Fmn2	A	G	1: 174,609,895	E1144G	probably damaging	Het
Fmo3	T	C	1: 162,968,838	Y55C	probably damaging	Het
Frmpd1	A	G	4: 45,229,865	T11A	probably damaging	Het
Ghdc	G	T	11: 100,770,103	Q79K	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm5591	T	C	7: 38,522,256	T130A	probably damaging	Het
Heg1	T	G	16: 33,719,772	D367E	probably benign	Het
Igkv13-84	C	T	6: 68,939,910	P64S	probably damaging	Het
Il10rb	T	A	16: 91,414,657	S128T	possibly damaging	Het
Il15ra	T	A	2: 11,718,306	I47N	probably damaging	Het
Il33	C	A	19: 29,958,911	S207*	probably null	Het
Itgb7	A	G	15: 102,224,413	Y155H	possibly damaging	Het
Kdm5a	A	G	6: 120,369,099		probably benign	Het
Kif11	G	A	19: 37,417,949	V987I	probably benign	Het
Krtap19-2	G	A	16: 88,873,874		probably benign	Het
Krtap24-1	T	A	16: 88,611,529	R236S	probably damaging	Het
L3mbtl2	A	G	15: 81,682,612	I406V	probably benign	Het
Lrp2	A	T	2: 69,459,715	H3593Q	possibly damaging	Het
Mavs	G	T	2: 131,240,365	W56C	probably damaging	Het
Mn1	C	T	5: 111,419,660	P499S	probably damaging	Het
Ntn5	T	A	7: 45,691,471	C178S	probably damaging	Het
Nufip2	A	G	11: 77,686,328	H34R	unknown	Het
Olfr470	T	A	7: 107,845,548	M62L	possibly damaging	Het
Olfr523	T	A	7: 140,176,450	L110Q	probably damaging	Het
Osbpl10	C	T	9: 115,109,530	S86L	probably damaging	Het
Pitpna	T	A	11: 75,620,327	M242K	possibly damaging	Het
Pnpla6	T	C	8: 3,522,838	V345A	probably benign	Het
Polk	A	G	13: 96,496,491		probably null	Het
Polr3k	A	G	2: 181,864,547	Y30C	probably damaging	Het
Pramel6	A	G	2: 87,509,597	H235R	probably benign	Het
Ptpra	G	A	2: 130,537,617	V364I	probably damaging	Het
Recql	A	G	6: 142,363,700		probably benign	Het
Ring1	T	C	17: 34,022,289		probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Samsn1	C	A	16: 75,947,289		noncoding transcript	Het
Scara5	A	G	14: 65,730,749	H157R	probably benign	Het
Sdc3	C	T	4: 130,819,065	P245L	probably damaging	Het
Slc18b1	T	A	10: 23,820,869	M318K	possibly damaging	Het
Slc26a10	C	T	10: 127,173,355	A638T	possibly damaging	Het
Slc35f2	T	A	9: 53,809,729	W259R	possibly damaging	Het
Spata13	G	A	14: 60,753,907	W366*	probably null	Het
Sptlc3	A	G	2: 139,589,589	T344A	probably benign	Het
Tap1	T	C	17: 34,193,891	V560A	probably damaging	Het
Tbc1d1	T	C	5: 64,278,046		probably null	Het
Tlr11	A	G	14: 50,361,250	Y231C	possibly damaging	Het
Tmem245	A	T	4: 56,936,468	S230T	possibly damaging	Het
Tnnt3	C	T	7: 142,514,283		probably benign	Het
Traf7	C	G	17: 24,510,438		probably benign	Het
Tshz2	A	G	2: 169,962,681		probably benign	Het
Tshz3	T	C	7: 36,768,972	S129P	probably damaging	Het
Ttc6	A	T	12: 57,729,451	N1727I	probably damaging	Het
Ttc7b	A	G	12: 100,403,362	S383P	probably damaging	Het
Tulp3	T	A	6: 128,323,120	I448F	probably damaging	Het
Vav1	G	A	17: 57,296,552	V84I	probably damaging	Het
Vav3	A	T	3: 109,508,794	K243I	possibly damaging	Het
Vmn1r25	T	A	6: 57,979,026	I93F	probably damaging	Het
Vmn2r73	C	T	7: 85,871,715	W348*	probably null	Het
Zdbf2	A	G	1: 63,303,238	R259G	possibly damaging	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	splice site	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4824:Ube3b	UTSW	5	114415726	splice site	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
R7640:Ube3b	UTSW	5	114415323	missense	probably benign
R7825:Ube3b	UTSW	5	114401312	missense	probably damaging	1.00
R7958:Ube3b	UTSW	5	114401423	missense	probably benign	0.05
R8025:Ube3b	UTSW	5	114408209	missense	probably damaging	0.99
R8058:Ube3b	UTSW	5	114406785	missense	possibly damaging	0.58
R8087:Ube3b	UTSW	5	114412489	critical splice donor site	probably null
R8182:Ube3b	UTSW	5	114392138	missense	possibly damaging	0.77
R8322:Ube3b	UTSW	5	114402686	missense	probably benign	0.04
R8465:Ube3b	UTSW	5	114390390	missense	probably damaging	1.00
R8682:Ube3b	UTSW	5	114412290	missense	probably damaging	1.00
R8708:Ube3b	UTSW	5	114393090	missense	probably benign	0.34
R8758:Ube3b	UTSW	5	114415200	critical splice acceptor site	probably benign
R8784:Ube3b	UTSW	5	114388739	missense	probably damaging	1.00
R9058:Ube3b	UTSW	5	114415239	missense	probably benign	0.05
R9072:Ube3b	UTSW	5	114404546	missense	probably damaging	0.98
R9116:Ube3b	UTSW	5	114404776	intron	probably benign
R9537:Ube3b	UTSW	5	114387184	missense	probably damaging	1.00
R9596:Ube3b	UTSW	5	114389110	missense	probably damaging	1.00
R9632:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
R9710:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- TACGTACCTGGATGACCTGC -3'
(R):5'- TGCCACATGCTTTCTGAATGTC -3'

Sequencing Primer
(F):5'- TGGATGACCTGCTGCCCAAG -3'
(R):5'- ATGGCTTCCTGCAATGTTGTC -3'

Posted On

2015-12-29