Incidental Mutation 'R4779:Ephb4'
ID 368139
Institutional Source Beutler Lab
Gene Symbol Ephb4
Ensembl Gene ENSMUSG00000029710
Gene Name Eph receptor B4
Synonyms MDK2, Htk, b2b2412Clo, Myk1, Tyro11
MMRRC Submission 045240-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4779 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 137348371-137372784 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 137363964 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 612 (V612A)
Ref Sequence ENSEMBL: ENSMUSP00000130275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]
AlphaFold P54761
Predicted Effect probably benign
Transcript: ENSMUST00000061244
AA Change: V612A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: V612A

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111054
AA Change: V612A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: V612A

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 1.4e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 3.4e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
Pfam:SAM_1 882 917 2.6e-7 PFAM
low complexity region 919 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111055
AA Change: V621A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: V621A

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 4.2e-10 PFAM
FN3 324 413 1.75e-6 SMART
FN3 443 525 1.07e-10 SMART
Pfam:EphA2_TM 550 621 5e-24 PFAM
TyrKc 624 883 5.09e-130 SMART
SAM 913 980 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144296
AA Change: V612A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: V612A

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166239
AA Change: V612A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: V612A

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Meta Mutation Damage Score 0.1016 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,667,613 (GRCm39) S335T unknown Het
4933421I07Rik T A 7: 42,097,455 (GRCm39) H13L possibly damaging Het
6030468B19Rik A G 11: 117,696,834 (GRCm39) T185A probably benign Het
Abcc1 T A 16: 14,228,635 (GRCm39) V294E probably benign Het
Abhd16b A G 2: 181,135,253 (GRCm39) T52A possibly damaging Het
Actl7a A T 4: 56,743,632 (GRCm39) N53I probably benign Het
Ankmy1 T C 1: 92,814,445 (GRCm39) E354G probably benign Het
Arap1 T C 7: 101,053,574 (GRCm39) F1301S probably damaging Het
Arfgef1 A T 1: 10,223,958 (GRCm39) W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 62,936,187 (GRCm39) probably benign Het
Ccl24 T A 5: 135,601,811 (GRCm39) T6S possibly damaging Het
Cep152 G T 2: 125,410,812 (GRCm39) P1292Q possibly damaging Het
Cfap46 T C 7: 139,239,731 (GRCm39) probably benign Het
Chd6 A T 2: 160,791,477 (GRCm39) S2627T probably damaging Het
Chd8 A T 14: 52,468,963 (GRCm39) S552T probably damaging Het
Ciita C A 16: 10,329,230 (GRCm39) L502M probably damaging Het
Clic1 T C 17: 35,271,463 (GRCm39) F31S probably damaging Het
Cntnap1 T A 11: 101,068,898 (GRCm39) I147N possibly damaging Het
Cplane1 T C 15: 8,248,322 (GRCm39) S1624P probably benign Het
Crispld1 T A 1: 17,819,831 (GRCm39) D276E probably benign Het
Cspg4 A T 9: 56,793,092 (GRCm39) N276Y probably damaging Het
Cspg4b A T 13: 113,504,870 (GRCm39) N2000Y possibly damaging Het
Cwf19l2 A G 9: 3,410,035 (GRCm39) M55V possibly damaging Het
Cyp2c69 T C 19: 39,866,038 (GRCm39) N185S probably benign Het
Dop1b T C 16: 93,553,969 (GRCm39) I301T probably damaging Het
Epg5 T C 18: 78,034,580 (GRCm39) V1443A probably benign Het
Fcgbp T A 7: 27,794,362 (GRCm39) C1189S probably damaging Het
Fgfr2 T G 7: 129,786,923 (GRCm39) probably benign Het
Fmn2 A G 1: 174,437,461 (GRCm39) E1144G probably damaging Het
Fmo3 T C 1: 162,796,407 (GRCm39) Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 (GRCm39) T11A probably damaging Het
Ghdc G T 11: 100,660,929 (GRCm39) Q79K possibly damaging Het
Gm11677 C T 11: 111,615,537 (GRCm39) noncoding transcript Het
Gm5591 T C 7: 38,221,680 (GRCm39) T130A probably damaging Het
Heg1 T G 16: 33,540,142 (GRCm39) D367E probably benign Het
Igkv13-84 C T 6: 68,916,894 (GRCm39) P64S probably damaging Het
Il10rb T A 16: 91,211,545 (GRCm39) S128T possibly damaging Het
Il15ra T A 2: 11,723,117 (GRCm39) I47N probably damaging Het
Il33 C A 19: 29,936,311 (GRCm39) S207* probably null Het
Itgb7 A G 15: 102,132,848 (GRCm39) Y155H possibly damaging Het
Kdm5a A G 6: 120,346,060 (GRCm39) probably benign Het
Kif11 G A 19: 37,406,397 (GRCm39) V987I probably benign Het
Krtap19-2 G A 16: 88,670,762 (GRCm39) probably benign Het
Krtap24-1 T A 16: 88,408,417 (GRCm39) R236S probably damaging Het
L3mbtl2 A G 15: 81,566,813 (GRCm39) I406V probably benign Het
Lrp2 A T 2: 69,290,059 (GRCm39) H3593Q possibly damaging Het
Mavs G T 2: 131,082,285 (GRCm39) W56C probably damaging Het
Mn1 C T 5: 111,567,526 (GRCm39) P499S probably damaging Het
Ntn5 T A 7: 45,340,895 (GRCm39) C178S probably damaging Het
Nufip2 A G 11: 77,577,154 (GRCm39) H34R unknown Het
Or5p51 T A 7: 107,444,755 (GRCm39) M62L possibly damaging Het
Or6f2 T A 7: 139,756,363 (GRCm39) L110Q probably damaging Het
Osbpl10 C T 9: 114,938,598 (GRCm39) S86L probably damaging Het
Pitpna T A 11: 75,511,153 (GRCm39) M242K possibly damaging Het
Pnpla6 T C 8: 3,572,838 (GRCm39) V345A probably benign Het
Polk A G 13: 96,632,999 (GRCm39) probably null Het
Polr3k A G 2: 181,506,340 (GRCm39) Y30C probably damaging Het
Pramel6 A G 2: 87,339,941 (GRCm39) H235R probably benign Het
Ptpra G A 2: 130,379,537 (GRCm39) V364I probably damaging Het
Recql A G 6: 142,309,426 (GRCm39) probably benign Het
Ring1 T C 17: 34,241,263 (GRCm39) probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Samsn1 C A 16: 75,744,177 (GRCm39) noncoding transcript Het
Scara5 A G 14: 65,968,198 (GRCm39) H157R probably benign Het
Sdc3 C T 4: 130,546,376 (GRCm39) P245L probably damaging Het
Slc18b1 T A 10: 23,696,767 (GRCm39) M318K possibly damaging Het
Slc26a10 C T 10: 127,009,224 (GRCm39) A638T possibly damaging Het
Slc35f2 T A 9: 53,717,013 (GRCm39) W259R possibly damaging Het
Spata13 G A 14: 60,991,356 (GRCm39) W366* probably null Het
Sptlc3 A G 2: 139,431,509 (GRCm39) T344A probably benign Het
Tap1 T C 17: 34,412,865 (GRCm39) V560A probably damaging Het
Tbc1d1 T C 5: 64,435,389 (GRCm39) probably null Het
Tlr11 A G 14: 50,598,707 (GRCm39) Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 (GRCm39) S230T possibly damaging Het
Tnnt3 C T 7: 142,068,020 (GRCm39) probably benign Het
Traf7 C G 17: 24,729,412 (GRCm39) probably benign Het
Tshz2 A G 2: 169,804,601 (GRCm39) probably benign Het
Tshz3 T C 7: 36,468,397 (GRCm39) S129P probably damaging Het
Ttc6 A T 12: 57,776,237 (GRCm39) N1727I probably damaging Het
Ttc7b A G 12: 100,369,621 (GRCm39) S383P probably damaging Het
Tulp3 T A 6: 128,300,083 (GRCm39) I448F probably damaging Het
Ube3b T C 5: 114,542,778 (GRCm39) probably null Het
Vav1 G A 17: 57,603,552 (GRCm39) V84I probably damaging Het
Vav3 A T 3: 109,416,110 (GRCm39) K243I possibly damaging Het
Vmn1r25 T A 6: 57,956,011 (GRCm39) I93F probably damaging Het
Vmn2r73 C T 7: 85,520,923 (GRCm39) W348* probably null Het
Zdbf2 A G 1: 63,342,397 (GRCm39) R259G possibly damaging Het
Other mutations in Ephb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Ephb4 APN 5 137,363,877 (GRCm39) splice site probably benign
IGL00948:Ephb4 APN 5 137,364,921 (GRCm39) missense probably damaging 1.00
IGL01653:Ephb4 APN 5 137,364,003 (GRCm39) splice site probably benign
IGL01885:Ephb4 APN 5 137,356,059 (GRCm39) missense probably damaging 1.00
IGL01906:Ephb4 APN 5 137,359,456 (GRCm39) missense probably damaging 1.00
IGL02089:Ephb4 APN 5 137,369,024 (GRCm39) missense probably damaging 0.98
IGL02216:Ephb4 APN 5 137,370,332 (GRCm39) missense possibly damaging 0.92
IGL02233:Ephb4 APN 5 137,352,763 (GRCm39) nonsense probably null
IGL03080:Ephb4 APN 5 137,352,345 (GRCm39) splice site probably benign
IGL03111:Ephb4 APN 5 137,370,767 (GRCm39) missense probably benign 0.07
R0599:Ephb4 UTSW 5 137,368,117 (GRCm39) missense probably damaging 1.00
R0744:Ephb4 UTSW 5 137,363,929 (GRCm39) missense probably damaging 1.00
R1331:Ephb4 UTSW 5 137,364,796 (GRCm39) splice site probably benign
R1441:Ephb4 UTSW 5 137,359,509 (GRCm39) missense probably damaging 1.00
R1732:Ephb4 UTSW 5 137,370,440 (GRCm39) missense possibly damaging 0.93
R1745:Ephb4 UTSW 5 137,358,696 (GRCm39) missense probably benign
R1831:Ephb4 UTSW 5 137,352,677 (GRCm39) missense probably damaging 1.00
R1865:Ephb4 UTSW 5 137,361,572 (GRCm39) missense possibly damaging 0.53
R2165:Ephb4 UTSW 5 137,352,688 (GRCm39) missense probably benign 0.08
R2206:Ephb4 UTSW 5 137,355,981 (GRCm39) missense probably damaging 1.00
R2473:Ephb4 UTSW 5 137,363,962 (GRCm39) missense probably benign 0.15
R4801:Ephb4 UTSW 5 137,363,768 (GRCm39) missense probably damaging 1.00
R4802:Ephb4 UTSW 5 137,363,768 (GRCm39) missense probably damaging 1.00
R5307:Ephb4 UTSW 5 137,361,574 (GRCm39) missense probably damaging 1.00
R5452:Ephb4 UTSW 5 137,359,404 (GRCm39) missense probably damaging 1.00
R5458:Ephb4 UTSW 5 137,368,114 (GRCm39) missense probably damaging 1.00
R5475:Ephb4 UTSW 5 137,352,701 (GRCm39) missense probably benign 0.00
R5662:Ephb4 UTSW 5 137,370,457 (GRCm39) missense probably damaging 0.98
R5879:Ephb4 UTSW 5 137,358,678 (GRCm39) missense probably benign 0.00
R6336:Ephb4 UTSW 5 137,370,347 (GRCm39) missense probably damaging 1.00
R6443:Ephb4 UTSW 5 137,358,711 (GRCm39) missense probably damaging 1.00
R6632:Ephb4 UTSW 5 137,364,849 (GRCm39) missense probably damaging 0.99
R6973:Ephb4 UTSW 5 137,368,066 (GRCm39) missense probably damaging 1.00
R7008:Ephb4 UTSW 5 137,359,536 (GRCm39) missense probably benign 0.00
R7145:Ephb4 UTSW 5 137,370,308 (GRCm39) missense probably damaging 1.00
R7421:Ephb4 UTSW 5 137,352,687 (GRCm39) missense possibly damaging 0.88
R7593:Ephb4 UTSW 5 137,359,560 (GRCm39) missense probably benign
R7635:Ephb4 UTSW 5 137,370,365 (GRCm39) missense probably damaging 1.00
R7751:Ephb4 UTSW 5 137,363,937 (GRCm39) missense probably damaging 1.00
R7825:Ephb4 UTSW 5 137,370,699 (GRCm39) missense probably damaging 1.00
R8539:Ephb4 UTSW 5 137,356,117 (GRCm39) missense probably damaging 1.00
R8904:Ephb4 UTSW 5 137,369,067 (GRCm39) missense probably damaging 1.00
R9228:Ephb4 UTSW 5 137,352,824 (GRCm39) missense possibly damaging 0.79
R9327:Ephb4 UTSW 5 137,361,529 (GRCm39) missense probably damaging 0.99
R9513:Ephb4 UTSW 5 137,361,564 (GRCm39) missense possibly damaging 0.76
R9659:Ephb4 UTSW 5 137,363,743 (GRCm39) missense probably damaging 1.00
R9788:Ephb4 UTSW 5 137,363,743 (GRCm39) missense probably damaging 1.00
X0026:Ephb4 UTSW 5 137,371,820 (GRCm39) missense probably damaging 1.00
Z1177:Ephb4 UTSW 5 137,359,621 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTGGGTCACAGACAAGGGG -3'
(R):5'- ACATACGGTGTTTTCTTCTACCT -3'

Sequencing Primer
(F):5'- GAAGAAAGCAGCTTTGAGTTAATG -3'
(R):5'- CCTGGAACTTGCTATGTAGACCAG -3'
Posted On 2015-12-29