Incidental Mutation 'R4779:Cfap46'
ID 368154
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Name cilia and flagella associated protein 46
Synonyms 9330101J02Rik, Ttc40
MMRRC Submission 045240-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4779 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 139180867-139263733 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to C at 139239731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820] [ENSMUST00000155075]
AlphaFold E9Q2C0
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118750
Predicted Effect probably benign
Transcript: ENSMUST00000129990
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140820
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156116
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,667,613 (GRCm39) S335T unknown Het
4933421I07Rik T A 7: 42,097,455 (GRCm39) H13L possibly damaging Het
6030468B19Rik A G 11: 117,696,834 (GRCm39) T185A probably benign Het
Abcc1 T A 16: 14,228,635 (GRCm39) V294E probably benign Het
Abhd16b A G 2: 181,135,253 (GRCm39) T52A possibly damaging Het
Actl7a A T 4: 56,743,632 (GRCm39) N53I probably benign Het
Ankmy1 T C 1: 92,814,445 (GRCm39) E354G probably benign Het
Arap1 T C 7: 101,053,574 (GRCm39) F1301S probably damaging Het
Arfgef1 A T 1: 10,223,958 (GRCm39) W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 62,936,187 (GRCm39) probably benign Het
Ccl24 T A 5: 135,601,811 (GRCm39) T6S possibly damaging Het
Cep152 G T 2: 125,410,812 (GRCm39) P1292Q possibly damaging Het
Chd6 A T 2: 160,791,477 (GRCm39) S2627T probably damaging Het
Chd8 A T 14: 52,468,963 (GRCm39) S552T probably damaging Het
Ciita C A 16: 10,329,230 (GRCm39) L502M probably damaging Het
Clic1 T C 17: 35,271,463 (GRCm39) F31S probably damaging Het
Cntnap1 T A 11: 101,068,898 (GRCm39) I147N possibly damaging Het
Cplane1 T C 15: 8,248,322 (GRCm39) S1624P probably benign Het
Crispld1 T A 1: 17,819,831 (GRCm39) D276E probably benign Het
Cspg4 A T 9: 56,793,092 (GRCm39) N276Y probably damaging Het
Cspg4b A T 13: 113,504,870 (GRCm39) N2000Y possibly damaging Het
Cwf19l2 A G 9: 3,410,035 (GRCm39) M55V possibly damaging Het
Cyp2c69 T C 19: 39,866,038 (GRCm39) N185S probably benign Het
Dop1b T C 16: 93,553,969 (GRCm39) I301T probably damaging Het
Epg5 T C 18: 78,034,580 (GRCm39) V1443A probably benign Het
Ephb4 T C 5: 137,363,964 (GRCm39) V612A probably benign Het
Fcgbp T A 7: 27,794,362 (GRCm39) C1189S probably damaging Het
Fgfr2 T G 7: 129,786,923 (GRCm39) probably benign Het
Fmn2 A G 1: 174,437,461 (GRCm39) E1144G probably damaging Het
Fmo3 T C 1: 162,796,407 (GRCm39) Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 (GRCm39) T11A probably damaging Het
Ghdc G T 11: 100,660,929 (GRCm39) Q79K possibly damaging Het
Gm11677 C T 11: 111,615,537 (GRCm39) noncoding transcript Het
Gm5591 T C 7: 38,221,680 (GRCm39) T130A probably damaging Het
Heg1 T G 16: 33,540,142 (GRCm39) D367E probably benign Het
Igkv13-84 C T 6: 68,916,894 (GRCm39) P64S probably damaging Het
Il10rb T A 16: 91,211,545 (GRCm39) S128T possibly damaging Het
Il15ra T A 2: 11,723,117 (GRCm39) I47N probably damaging Het
Il33 C A 19: 29,936,311 (GRCm39) S207* probably null Het
Itgb7 A G 15: 102,132,848 (GRCm39) Y155H possibly damaging Het
Kdm5a A G 6: 120,346,060 (GRCm39) probably benign Het
Kif11 G A 19: 37,406,397 (GRCm39) V987I probably benign Het
Krtap19-2 G A 16: 88,670,762 (GRCm39) probably benign Het
Krtap24-1 T A 16: 88,408,417 (GRCm39) R236S probably damaging Het
L3mbtl2 A G 15: 81,566,813 (GRCm39) I406V probably benign Het
Lrp2 A T 2: 69,290,059 (GRCm39) H3593Q possibly damaging Het
Mavs G T 2: 131,082,285 (GRCm39) W56C probably damaging Het
Mn1 C T 5: 111,567,526 (GRCm39) P499S probably damaging Het
Ntn5 T A 7: 45,340,895 (GRCm39) C178S probably damaging Het
Nufip2 A G 11: 77,577,154 (GRCm39) H34R unknown Het
Or5p51 T A 7: 107,444,755 (GRCm39) M62L possibly damaging Het
Or6f2 T A 7: 139,756,363 (GRCm39) L110Q probably damaging Het
Osbpl10 C T 9: 114,938,598 (GRCm39) S86L probably damaging Het
Pitpna T A 11: 75,511,153 (GRCm39) M242K possibly damaging Het
Pnpla6 T C 8: 3,572,838 (GRCm39) V345A probably benign Het
Polk A G 13: 96,632,999 (GRCm39) probably null Het
Polr3k A G 2: 181,506,340 (GRCm39) Y30C probably damaging Het
Pramel6 A G 2: 87,339,941 (GRCm39) H235R probably benign Het
Ptpra G A 2: 130,379,537 (GRCm39) V364I probably damaging Het
Recql A G 6: 142,309,426 (GRCm39) probably benign Het
Ring1 T C 17: 34,241,263 (GRCm39) probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Samsn1 C A 16: 75,744,177 (GRCm39) noncoding transcript Het
Scara5 A G 14: 65,968,198 (GRCm39) H157R probably benign Het
Sdc3 C T 4: 130,546,376 (GRCm39) P245L probably damaging Het
Slc18b1 T A 10: 23,696,767 (GRCm39) M318K possibly damaging Het
Slc26a10 C T 10: 127,009,224 (GRCm39) A638T possibly damaging Het
Slc35f2 T A 9: 53,717,013 (GRCm39) W259R possibly damaging Het
Spata13 G A 14: 60,991,356 (GRCm39) W366* probably null Het
Sptlc3 A G 2: 139,431,509 (GRCm39) T344A probably benign Het
Tap1 T C 17: 34,412,865 (GRCm39) V560A probably damaging Het
Tbc1d1 T C 5: 64,435,389 (GRCm39) probably null Het
Tlr11 A G 14: 50,598,707 (GRCm39) Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 (GRCm39) S230T possibly damaging Het
Tnnt3 C T 7: 142,068,020 (GRCm39) probably benign Het
Traf7 C G 17: 24,729,412 (GRCm39) probably benign Het
Tshz2 A G 2: 169,804,601 (GRCm39) probably benign Het
Tshz3 T C 7: 36,468,397 (GRCm39) S129P probably damaging Het
Ttc6 A T 12: 57,776,237 (GRCm39) N1727I probably damaging Het
Ttc7b A G 12: 100,369,621 (GRCm39) S383P probably damaging Het
Tulp3 T A 6: 128,300,083 (GRCm39) I448F probably damaging Het
Ube3b T C 5: 114,542,778 (GRCm39) probably null Het
Vav1 G A 17: 57,603,552 (GRCm39) V84I probably damaging Het
Vav3 A T 3: 109,416,110 (GRCm39) K243I possibly damaging Het
Vmn1r25 T A 6: 57,956,011 (GRCm39) I93F probably damaging Het
Vmn2r73 C T 7: 85,520,923 (GRCm39) W348* probably null Het
Zdbf2 A G 1: 63,342,397 (GRCm39) R259G possibly damaging Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139,194,359 (GRCm39) missense probably benign 0.06
IGL00505:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139,240,605 (GRCm39) missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139,246,895 (GRCm39) missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139,186,523 (GRCm39) missense unknown
IGL02171:Cfap46 APN 7 139,246,972 (GRCm39) missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139,262,425 (GRCm39) missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139,194,386 (GRCm39) missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139,187,117 (GRCm39) missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139,183,168 (GRCm39) missense unknown
IGL03329:Cfap46 APN 7 139,181,081 (GRCm39) missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139,218,711 (GRCm39) utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139,218,846 (GRCm39) utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139,218,846 (GRCm39) utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139,225,467 (GRCm39) missense
R0051:Cfap46 UTSW 7 139,255,951 (GRCm39) missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139,255,951 (GRCm39) missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139,234,482 (GRCm39) missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139,231,449 (GRCm39) splice site probably benign
R0650:Cfap46 UTSW 7 139,185,571 (GRCm39) missense unknown
R0675:Cfap46 UTSW 7 139,255,950 (GRCm39) missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139,234,586 (GRCm39) missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139,235,757 (GRCm39) missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139,222,513 (GRCm39) missense probably benign 0.42
R1251:Cfap46 UTSW 7 139,181,181 (GRCm39) missense probably benign 0.40
R1257:Cfap46 UTSW 7 139,234,545 (GRCm39) nonsense probably null
R1538:Cfap46 UTSW 7 139,262,924 (GRCm39) missense probably null 1.00
R1618:Cfap46 UTSW 7 139,232,726 (GRCm39) missense probably benign 0.04
R1655:Cfap46 UTSW 7 139,222,436 (GRCm39) nonsense probably null
R1824:Cfap46 UTSW 7 139,219,518 (GRCm39) missense probably benign 0.12
R1830:Cfap46 UTSW 7 139,220,323 (GRCm39) missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139,233,324 (GRCm39) missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139,263,386 (GRCm39) missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139,259,819 (GRCm39) missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139,246,957 (GRCm39) missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139,263,677 (GRCm39) missense probably benign 0.03
R2354:Cfap46 UTSW 7 139,240,962 (GRCm39) missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139,233,414 (GRCm39) missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139,197,506 (GRCm39) missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139,219,515 (GRCm39) missense probably benign 0.06
R3949:Cfap46 UTSW 7 139,258,467 (GRCm39) missense probably benign 0.12
R4239:Cfap46 UTSW 7 139,246,203 (GRCm39) missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139,246,203 (GRCm39) missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139,232,589 (GRCm39) missense probably benign 0.27
R4365:Cfap46 UTSW 7 139,230,868 (GRCm39) missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139,239,998 (GRCm39) intron probably benign
R4595:Cfap46 UTSW 7 139,232,320 (GRCm39) missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139,260,843 (GRCm39) missense probably damaging 1.00
R4627:Cfap46 UTSW 7 139,237,197 (GRCm39) missense probably damaging 0.99
R4628:Cfap46 UTSW 7 139,260,843 (GRCm39) missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139,260,843 (GRCm39) missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139,207,372 (GRCm39) missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139,259,239 (GRCm39) critical splice donor site probably null
R4771:Cfap46 UTSW 7 139,210,524 (GRCm39) missense probably null
R4812:Cfap46 UTSW 7 139,215,916 (GRCm39) missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139,187,104 (GRCm39) critical splice donor site probably null
R5014:Cfap46 UTSW 7 139,207,291 (GRCm39) missense probably benign 0.12
R5033:Cfap46 UTSW 7 139,183,776 (GRCm39) missense probably benign 0.00
R5055:Cfap46 UTSW 7 139,241,106 (GRCm39) missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139,258,430 (GRCm39) missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139,193,423 (GRCm39) critical splice donor site probably null
R5366:Cfap46 UTSW 7 139,230,802 (GRCm39) missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139,207,389 (GRCm39) missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139,212,097 (GRCm39) splice site probably null
R5642:Cfap46 UTSW 7 139,258,493 (GRCm39) missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139,218,269 (GRCm39) missense probably benign 0.01
R5691:Cfap46 UTSW 7 139,186,616 (GRCm39) missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139,191,947 (GRCm39) missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139,230,858 (GRCm39) missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139,231,511 (GRCm39) missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139,218,816 (GRCm39) utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139,236,496 (GRCm39) missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139,218,816 (GRCm39) utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139,218,816 (GRCm39) utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139,241,001 (GRCm39) missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139,260,747 (GRCm39) missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139,194,321 (GRCm39) critical splice donor site probably null
R6736:Cfap46 UTSW 7 139,199,887 (GRCm39) missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139,232,356 (GRCm39) missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139,222,477 (GRCm39) utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139,232,414 (GRCm39) missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139,234,477 (GRCm39) critical splice donor site probably null
R6912:Cfap46 UTSW 7 139,219,616 (GRCm39) missense probably benign 0.09
R7163:Cfap46 UTSW 7 139,197,994 (GRCm39) critical splice donor site probably null
R7232:Cfap46 UTSW 7 139,197,493 (GRCm39) missense unknown
R7327:Cfap46 UTSW 7 139,215,062 (GRCm39) splice site probably null
R7336:Cfap46 UTSW 7 139,200,020 (GRCm39) missense unknown
R7337:Cfap46 UTSW 7 139,210,492 (GRCm39) critical splice donor site probably null
R7437:Cfap46 UTSW 7 139,230,753 (GRCm39) nonsense probably null
R7450:Cfap46 UTSW 7 139,197,353 (GRCm39) missense unknown
R7495:Cfap46 UTSW 7 139,183,112 (GRCm39) critical splice donor site probably null
R7618:Cfap46 UTSW 7 139,183,155 (GRCm39) missense
R7623:Cfap46 UTSW 7 139,198,266 (GRCm39) missense unknown
R7765:Cfap46 UTSW 7 139,231,480 (GRCm39) missense
R7971:Cfap46 UTSW 7 139,215,043 (GRCm39) missense unknown
R8211:Cfap46 UTSW 7 139,213,220 (GRCm39) missense unknown
R8306:Cfap46 UTSW 7 139,236,496 (GRCm39) missense
R8354:Cfap46 UTSW 7 139,233,414 (GRCm39) missense probably benign 0.03
R8365:Cfap46 UTSW 7 139,263,000 (GRCm39) nonsense probably null
R8447:Cfap46 UTSW 7 139,260,902 (GRCm39) missense possibly damaging 0.90
R8715:Cfap46 UTSW 7 139,185,560 (GRCm39) missense
R8805:Cfap46 UTSW 7 139,211,979 (GRCm39) missense unknown
R8830:Cfap46 UTSW 7 139,195,565 (GRCm39) missense unknown
R8912:Cfap46 UTSW 7 139,260,097 (GRCm39) intron probably benign
R8920:Cfap46 UTSW 7 139,232,442 (GRCm39) missense
R8977:Cfap46 UTSW 7 139,259,849 (GRCm39) missense probably benign 0.01
R9048:Cfap46 UTSW 7 139,207,259 (GRCm39) missense unknown
R9224:Cfap46 UTSW 7 139,258,416 (GRCm39) nonsense probably null
R9243:Cfap46 UTSW 7 139,195,265 (GRCm39) intron probably benign
R9252:Cfap46 UTSW 7 139,198,165 (GRCm39) missense unknown
R9276:Cfap46 UTSW 7 139,201,207 (GRCm39) missense unknown
R9301:Cfap46 UTSW 7 139,222,461 (GRCm39) missense
R9391:Cfap46 UTSW 7 139,198,027 (GRCm39) missense unknown
R9402:Cfap46 UTSW 7 139,215,865 (GRCm39) missense unknown
R9443:Cfap46 UTSW 7 139,195,023 (GRCm39) missense
R9564:Cfap46 UTSW 7 139,231,471 (GRCm39) missense
R9625:Cfap46 UTSW 7 139,230,805 (GRCm39) missense
R9626:Cfap46 UTSW 7 139,230,805 (GRCm39) missense
R9638:Cfap46 UTSW 7 139,209,763 (GRCm39) missense unknown
R9656:Cfap46 UTSW 7 139,235,816 (GRCm39) missense
R9658:Cfap46 UTSW 7 139,246,229 (GRCm39) missense
R9747:Cfap46 UTSW 7 139,191,907 (GRCm39) missense unknown
RF023:Cfap46 UTSW 7 139,218,834 (GRCm39)
W0251:Cfap46 UTSW 7 139,183,862 (GRCm39) missense probably benign 0.11
X0018:Cfap46 UTSW 7 139,260,828 (GRCm39) missense probably benign 0.03
X0064:Cfap46 UTSW 7 139,183,363 (GRCm39) missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139,214,980 (GRCm39) missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139,219,464 (GRCm39) missense
Z1177:Cfap46 UTSW 7 139,210,542 (GRCm39) missense unknown
Z1177:Cfap46 UTSW 7 139,181,183 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGGAGTCCTCACAGTGAG -3'
(R):5'- AAACAGAGTGCATCCTGGGTTG -3'

Sequencing Primer
(F):5'- GGAAGAAGGCTCTGATACTTTATTC -3'
(R):5'- ACCACCCTATGCCCTGAGG -3'
Posted On 2015-12-29