Incidental Mutation 'R4779:Pnpla6'
ID368157
Institutional Source Beutler Lab
Gene Symbol Pnpla6
Ensembl Gene ENSMUSG00000004565
Gene Namepatatin-like phospholipase domain containing 6
SynonymsNte, Swiss-cheese, MSws
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4779 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3515384-3544267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3522838 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 345 (V345A)
Ref Sequence ENSEMBL: ENSMUSP00000146680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004681] [ENSMUST00000111070] [ENSMUST00000207424] [ENSMUST00000207941] [ENSMUST00000208002] [ENSMUST00000208762]
Predicted Effect probably benign
Transcript: ENSMUST00000004681
AA Change: V323A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004681
Gene: ENSMUSG00000004565
AA Change: V323A

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111070
AA Change: V323A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106699
Gene: ENSMUSG00000004565
AA Change: V323A

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207430
Predicted Effect probably benign
Transcript: ENSMUST00000207941
AA Change: V355A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000208002
AA Change: V345A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208315
Predicted Effect probably benign
Transcript: ENSMUST00000208762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208851
Meta Mutation Damage Score 0.0699 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase that deacetylates intracellular phosphatidylcholine to produce glycerophosphocholine. It is thought to function in neurite outgrowth and process elongation during neuronal differentiation. The protein is anchored to the cytoplasmic face of the endoplasmic reticulum in both neurons and non-neuronal cells. Mutations in this gene result in autosomal recessive spastic paraplegia, and the protein is the target for neurodegeneration induced by organophosphorus compounds and chemical warfare agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during early gestation. Conditional inactivation in the central nervous system leads to neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,838 S1624P probably benign Het
4930562C15Rik T A 16: 4,849,749 S335T unknown Het
4933421I07Rik T A 7: 42,448,031 H13L possibly damaging Het
6030468B19Rik A G 11: 117,806,008 T185A probably benign Het
Abcc1 T A 16: 14,410,771 V294E probably benign Het
Abhd16b A G 2: 181,493,460 T52A possibly damaging Het
Actl7a A T 4: 56,743,632 N53I probably benign Het
Ankmy1 T C 1: 92,886,723 E354G probably benign Het
Arap1 T C 7: 101,404,367 F1301S probably damaging Het
Arfgef1 A T 1: 10,153,733 W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 63,100,408 probably benign Het
BC067074 A T 13: 113,368,336 N2000Y possibly damaging Het
Ccl24 T A 5: 135,572,957 T6S possibly damaging Het
Cep152 G T 2: 125,568,892 P1292Q possibly damaging Het
Cfap46 T C 7: 139,659,815 probably benign Het
Chd6 A T 2: 160,949,557 S2627T probably damaging Het
Chd8 A T 14: 52,231,506 S552T probably damaging Het
Ciita C A 16: 10,511,366 L502M probably damaging Het
Clic1 T C 17: 35,052,487 F31S probably damaging Het
Cntnap1 T A 11: 101,178,072 I147N possibly damaging Het
Crispld1 T A 1: 17,749,607 D276E probably benign Het
Cspg4 A T 9: 56,885,808 N276Y probably damaging Het
Cwf19l2 A G 9: 3,410,035 M55V possibly damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dopey2 T C 16: 93,757,081 I301T probably damaging Het
Epg5 T C 18: 77,991,365 V1443A probably benign Het
Ephb4 T C 5: 137,365,702 V612A probably benign Het
Fcgbp T A 7: 28,094,937 C1189S probably damaging Het
Fgfr2 T G 7: 130,185,193 probably benign Het
Fmn2 A G 1: 174,609,895 E1144G probably damaging Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 T11A probably damaging Het
Ghdc G T 11: 100,770,103 Q79K possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Heg1 T G 16: 33,719,772 D367E probably benign Het
Igkv13-84 C T 6: 68,939,910 P64S probably damaging Het
Il10rb T A 16: 91,414,657 S128T possibly damaging Het
Il15ra T A 2: 11,718,306 I47N probably damaging Het
Il33 C A 19: 29,958,911 S207* probably null Het
Itgb7 A G 15: 102,224,413 Y155H possibly damaging Het
Kdm5a A G 6: 120,369,099 probably benign Het
Kif11 G A 19: 37,417,949 V987I probably benign Het
Krtap19-2 G A 16: 88,873,874 probably benign Het
Krtap24-1 T A 16: 88,611,529 R236S probably damaging Het
L3mbtl2 A G 15: 81,682,612 I406V probably benign Het
Lrp2 A T 2: 69,459,715 H3593Q possibly damaging Het
Mavs G T 2: 131,240,365 W56C probably damaging Het
Mn1 C T 5: 111,419,660 P499S probably damaging Het
Ntn5 T A 7: 45,691,471 C178S probably damaging Het
Nufip2 A G 11: 77,686,328 H34R unknown Het
Olfr470 T A 7: 107,845,548 M62L possibly damaging Het
Olfr523 T A 7: 140,176,450 L110Q probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Polk A G 13: 96,496,491 probably null Het
Polr3k A G 2: 181,864,547 Y30C probably damaging Het
Pramel6 A G 2: 87,509,597 H235R probably benign Het
Ptpra G A 2: 130,537,617 V364I probably damaging Het
Recql A G 6: 142,363,700 probably benign Het
Ring1 T C 17: 34,022,289 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 C A 16: 75,947,289 noncoding transcript Het
Scara5 A G 14: 65,730,749 H157R probably benign Het
Sdc3 C T 4: 130,819,065 P245L probably damaging Het
Slc18b1 T A 10: 23,820,869 M318K possibly damaging Het
Slc26a10 C T 10: 127,173,355 A638T possibly damaging Het
Slc35f2 T A 9: 53,809,729 W259R possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Sptlc3 A G 2: 139,589,589 T344A probably benign Het
Tap1 T C 17: 34,193,891 V560A probably damaging Het
Tbc1d1 T C 5: 64,278,046 probably null Het
Tlr11 A G 14: 50,361,250 Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 S230T possibly damaging Het
Tnnt3 C T 7: 142,514,283 probably benign Het
Traf7 C G 17: 24,510,438 probably benign Het
Tshz2 A G 2: 169,962,681 probably benign Het
Tshz3 T C 7: 36,768,972 S129P probably damaging Het
Ttc6 A T 12: 57,729,451 N1727I probably damaging Het
Ttc7b A G 12: 100,403,362 S383P probably damaging Het
Tulp3 T A 6: 128,323,120 I448F probably damaging Het
Ube3b T C 5: 114,404,717 probably null Het
Vav1 G A 17: 57,296,552 V84I probably damaging Het
Vav3 A T 3: 109,508,794 K243I possibly damaging Het
Vmn1r25 T A 6: 57,979,026 I93F probably damaging Het
Vmn2r73 C T 7: 85,871,715 W348* probably null Het
Zdbf2 A G 1: 63,303,238 R259G possibly damaging Het
Other mutations in Pnpla6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pnpla6 APN 8 3523808 missense probably damaging 1.00
IGL00820:Pnpla6 APN 8 3532358 missense possibly damaging 0.95
IGL00839:Pnpla6 APN 8 3542299 missense probably benign 0.05
IGL01732:Pnpla6 APN 8 3522616 missense probably damaging 0.99
IGL01973:Pnpla6 APN 8 3517619 missense probably damaging 1.00
IGL02267:Pnpla6 APN 8 3517327 missense probably benign 0.00
IGL03246:Pnpla6 APN 8 3531530 missense probably benign 0.01
IGL03286:Pnpla6 APN 8 3531473 missense probably damaging 0.99
I0000:Pnpla6 UTSW 8 3542322 missense probably benign
R0141:Pnpla6 UTSW 8 3532117 critical splice donor site probably null
R0180:Pnpla6 UTSW 8 3524250 critical splice acceptor site probably null
R0377:Pnpla6 UTSW 8 3541501 missense probably damaging 1.00
R0563:Pnpla6 UTSW 8 3523333 missense possibly damaging 0.51
R0660:Pnpla6 UTSW 8 3522269 unclassified probably benign
R0786:Pnpla6 UTSW 8 3523317 missense probably benign
R0827:Pnpla6 UTSW 8 3517618 missense possibly damaging 0.71
R0882:Pnpla6 UTSW 8 3517081 missense probably damaging 1.00
R1512:Pnpla6 UTSW 8 3535459 splice site probably benign
R1552:Pnpla6 UTSW 8 3522403 missense probably damaging 1.00
R1609:Pnpla6 UTSW 8 3517135 missense probably damaging 1.00
R1770:Pnpla6 UTSW 8 3534634 missense possibly damaging 0.94
R1779:Pnpla6 UTSW 8 3541404 missense probably damaging 1.00
R1987:Pnpla6 UTSW 8 3542370 missense probably benign 0.00
R3079:Pnpla6 UTSW 8 3541512 missense probably benign 0.25
R3125:Pnpla6 UTSW 8 3534670 missense probably null 1.00
R4171:Pnpla6 UTSW 8 3543997 missense probably benign 0.09
R4281:Pnpla6 UTSW 8 3521513 missense probably damaging 1.00
R4674:Pnpla6 UTSW 8 3521412 missense probably damaging 1.00
R4776:Pnpla6 UTSW 8 3523818 missense probably benign 0.01
R5114:Pnpla6 UTSW 8 3522613 missense probably damaging 0.98
R5459:Pnpla6 UTSW 8 3535829 missense probably benign 0.01
R5510:Pnpla6 UTSW 8 3521397 missense probably damaging 0.99
R5538:Pnpla6 UTSW 8 3531508 missense probably benign 0.01
R5664:Pnpla6 UTSW 8 3537478 missense probably damaging 0.98
R6063:Pnpla6 UTSW 8 3524156 missense probably benign 0.21
R6314:Pnpla6 UTSW 8 3521572 missense probably benign 0.39
R6321:Pnpla6 UTSW 8 3544015 missense probably benign
R6454:Pnpla6 UTSW 8 3537986 missense probably damaging 0.99
R6477:Pnpla6 UTSW 8 3536627 missense probably benign 0.00
R6524:Pnpla6 UTSW 8 3534519 splice site probably null
R6809:Pnpla6 UTSW 8 3534611 missense possibly damaging 0.72
R6975:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7293:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7389:Pnpla6 UTSW 8 3543981 nonsense probably null
R7520:Pnpla6 UTSW 8 3537508 missense probably damaging 1.00
R7666:Pnpla6 UTSW 8 3541591 missense probably benign 0.01
R7733:Pnpla6 UTSW 8 3522660 missense probably benign 0.01
X0018:Pnpla6 UTSW 8 3517337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAGTCATGTGAGTTGGACAG -3'
(R):5'- CACTGCTTTCTACGGCCATG -3'

Sequencing Primer
(F):5'- TCATGTGAGTTGGACAGCAACAC -3'
(R):5'- TGTTAGGAAAAATGCACCAAACTG -3'
Posted On2015-12-29