Incidental Mutation 'R4779:Pitpna'
ID368166
Institutional Source Beutler Lab
Gene Symbol Pitpna
Ensembl Gene ENSMUSG00000017781
Gene Namephosphatidylinositol transfer protein, alpha
SynonymsPitpn, Pitp alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.817) question?
Stock #R4779 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location75588097-75628804 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75620327 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 242 (M242K)
Ref Sequence ENSEMBL: ENSMUSP00000137510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102509] [ENSMUST00000143219] [ENSMUST00000179445] [ENSMUST00000179521]
Predicted Effect probably benign
Transcript: ENSMUST00000102509
SMART Domains Protein: ENSMUSP00000099567
Gene: ENSMUSG00000017781

DomainStartEndE-ValueType
Pfam:IP_trans 2 99 1e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143219
AA Change: M241K

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115723
Gene: ENSMUSG00000017781
AA Change: M241K

DomainStartEndE-ValueType
Pfam:IP_trans 2 255 4.7e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153768
Predicted Effect possibly damaging
Transcript: ENSMUST00000179445
AA Change: M241K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137601
Gene: ENSMUSG00000017781
AA Change: M241K

DomainStartEndE-ValueType
Pfam:IP_trans 2 255 6.7e-146 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179521
AA Change: M242K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137510
Gene: ENSMUSG00000017781
AA Change: M242K

DomainStartEndE-ValueType
Pfam:IP_trans 2 254 3.2e-123 PFAM
Meta Mutation Damage Score 0.9622 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: This gene encodes a member of a family of lipid-binding proteins that transfer molecules of phosphatidylinositol or phosphatidylcholine between membrane surfaces. The protein is implicated in phospholipase C signaling and in the production of phosphatidylinositol 3,4,5-trisphosphate by phosphoinositide-3-kinase. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations of this gene result in motor coordination abnormalities and early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,838 S1624P probably benign Het
4930562C15Rik T A 16: 4,849,749 S335T unknown Het
4933421I07Rik T A 7: 42,448,031 H13L possibly damaging Het
6030468B19Rik A G 11: 117,806,008 T185A probably benign Het
Abcc1 T A 16: 14,410,771 V294E probably benign Het
Abhd16b A G 2: 181,493,460 T52A possibly damaging Het
Actl7a A T 4: 56,743,632 N53I probably benign Het
Ankmy1 T C 1: 92,886,723 E354G probably benign Het
Arap1 T C 7: 101,404,367 F1301S probably damaging Het
Arfgef1 A T 1: 10,153,733 W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 63,100,408 probably benign Het
BC067074 A T 13: 113,368,336 N2000Y possibly damaging Het
Ccl24 T A 5: 135,572,957 T6S possibly damaging Het
Cep152 G T 2: 125,568,892 P1292Q possibly damaging Het
Cfap46 T C 7: 139,659,815 probably benign Het
Chd6 A T 2: 160,949,557 S2627T probably damaging Het
Chd8 A T 14: 52,231,506 S552T probably damaging Het
Ciita C A 16: 10,511,366 L502M probably damaging Het
Clic1 T C 17: 35,052,487 F31S probably damaging Het
Cntnap1 T A 11: 101,178,072 I147N possibly damaging Het
Crispld1 T A 1: 17,749,607 D276E probably benign Het
Cspg4 A T 9: 56,885,808 N276Y probably damaging Het
Cwf19l2 A G 9: 3,410,035 M55V possibly damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dopey2 T C 16: 93,757,081 I301T probably damaging Het
Epg5 T C 18: 77,991,365 V1443A probably benign Het
Ephb4 T C 5: 137,365,702 V612A probably benign Het
Fcgbp T A 7: 28,094,937 C1189S probably damaging Het
Fgfr2 T G 7: 130,185,193 probably benign Het
Fmn2 A G 1: 174,609,895 E1144G probably damaging Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 T11A probably damaging Het
Ghdc G T 11: 100,770,103 Q79K possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Heg1 T G 16: 33,719,772 D367E probably benign Het
Igkv13-84 C T 6: 68,939,910 P64S probably damaging Het
Il10rb T A 16: 91,414,657 S128T possibly damaging Het
Il15ra T A 2: 11,718,306 I47N probably damaging Het
Il33 C A 19: 29,958,911 S207* probably null Het
Itgb7 A G 15: 102,224,413 Y155H possibly damaging Het
Kdm5a A G 6: 120,369,099 probably benign Het
Kif11 G A 19: 37,417,949 V987I probably benign Het
Krtap19-2 G A 16: 88,873,874 probably benign Het
Krtap24-1 T A 16: 88,611,529 R236S probably damaging Het
L3mbtl2 A G 15: 81,682,612 I406V probably benign Het
Lrp2 A T 2: 69,459,715 H3593Q possibly damaging Het
Mavs G T 2: 131,240,365 W56C probably damaging Het
Mn1 C T 5: 111,419,660 P499S probably damaging Het
Ntn5 T A 7: 45,691,471 C178S probably damaging Het
Nufip2 A G 11: 77,686,328 H34R unknown Het
Olfr470 T A 7: 107,845,548 M62L possibly damaging Het
Olfr523 T A 7: 140,176,450 L110Q probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pnpla6 T C 8: 3,522,838 V345A probably benign Het
Polk A G 13: 96,496,491 probably null Het
Polr3k A G 2: 181,864,547 Y30C probably damaging Het
Pramel6 A G 2: 87,509,597 H235R probably benign Het
Ptpra G A 2: 130,537,617 V364I probably damaging Het
Recql A G 6: 142,363,700 probably benign Het
Ring1 T C 17: 34,022,289 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 C A 16: 75,947,289 noncoding transcript Het
Scara5 A G 14: 65,730,749 H157R probably benign Het
Sdc3 C T 4: 130,819,065 P245L probably damaging Het
Slc18b1 T A 10: 23,820,869 M318K possibly damaging Het
Slc26a10 C T 10: 127,173,355 A638T possibly damaging Het
Slc35f2 T A 9: 53,809,729 W259R possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Sptlc3 A G 2: 139,589,589 T344A probably benign Het
Tap1 T C 17: 34,193,891 V560A probably damaging Het
Tbc1d1 T C 5: 64,278,046 probably null Het
Tlr11 A G 14: 50,361,250 Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 S230T possibly damaging Het
Tnnt3 C T 7: 142,514,283 probably benign Het
Traf7 C G 17: 24,510,438 probably benign Het
Tshz2 A G 2: 169,962,681 probably benign Het
Tshz3 T C 7: 36,768,972 S129P probably damaging Het
Ttc6 A T 12: 57,729,451 N1727I probably damaging Het
Ttc7b A G 12: 100,403,362 S383P probably damaging Het
Tulp3 T A 6: 128,323,120 I448F probably damaging Het
Ube3b T C 5: 114,404,717 probably null Het
Vav1 G A 17: 57,296,552 V84I probably damaging Het
Vav3 A T 3: 109,508,794 K243I possibly damaging Het
Vmn1r25 T A 6: 57,979,026 I93F probably damaging Het
Vmn2r73 C T 7: 85,871,715 W348* probably null Het
Zdbf2 A G 1: 63,303,238 R259G possibly damaging Het
Other mutations in Pitpna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03186:Pitpna APN 11 75612250 missense probably benign
R0111:Pitpna UTSW 11 75625484 missense probably benign 0.03
R1854:Pitpna UTSW 11 75609103 critical splice acceptor site probably null
R3017:Pitpna UTSW 11 75592190 missense probably damaging 1.00
R5622:Pitpna UTSW 11 75620327 missense possibly damaging 0.83
R5685:Pitpna UTSW 11 75620269 missense probably damaging 1.00
R6539:Pitpna UTSW 11 75598301 missense probably damaging 1.00
R6602:Pitpna UTSW 11 75620315 missense possibly damaging 0.94
R6937:Pitpna UTSW 11 75603731 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CAGTTTGGCAAAGGTCACTGAC -3'
(R):5'- CCTGGCAGTAACCTTATCCAC -3'

Sequencing Primer
(F):5'- TCACTGACCTGGGTGTGATCC -3'
(R):5'- CAACAGAGCCAGGCTTGTTCTTAG -3'
Posted On2015-12-29