Incidental Mutation 'R4779:Polk'
ID368174
Institutional Source Beutler Lab
Gene Symbol Polk
Ensembl Gene ENSMUSG00000021668
Gene Namepolymerase (DNA directed), kappa
SynonymsDinb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R4779 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location96480690-96542579 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 96496491 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000088950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022172] [ENSMUST00000091387] [ENSMUST00000220977] [ENSMUST00000221645] [ENSMUST00000221899] [ENSMUST00000222075] [ENSMUST00000222143] [ENSMUST00000222389]
Predicted Effect probably benign
Transcript: ENSMUST00000022172
SMART Domains Protein: ENSMUSP00000022172
Gene: ENSMUSG00000021668

DomainStartEndE-ValueType
Pfam:IMS 105 324 1.7e-47 PFAM
Pfam:IMS_C 406 525 5.5e-22 PFAM
PDB:2LSJ|B 559 582 9e-8 PDB
ZnF_Rad18 619 645 2.89e-9 SMART
ZnF_Rad18 761 787 2.31e-8 SMART
low complexity region 828 839 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000091387
SMART Domains Protein: ENSMUSP00000088950
Gene: ENSMUSG00000021668

DomainStartEndE-ValueType
Pfam:IMS 105 265 1.1e-37 PFAM
Pfam:IMS_C 346 469 8.8e-19 PFAM
PDB:2LSJ|B 500 523 9e-8 PDB
ZnF_Rad18 560 586 2.89e-9 SMART
ZnF_Rad18 702 728 2.31e-8 SMART
low complexity region 769 780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220977
Predicted Effect probably benign
Transcript: ENSMUST00000221645
Predicted Effect probably benign
Transcript: ENSMUST00000221899
Predicted Effect probably benign
Transcript: ENSMUST00000222075
Predicted Effect probably benign
Transcript: ENSMUST00000222143
Predicted Effect probably benign
Transcript: ENSMUST00000222389
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA polymerase type-Y family of proteins. The encoded protein is a specialized DNA polymerase that catalyzes translesion DNA synthesis, which allows DNA replication in the presence of DNA lesions. Human cell lines lacking a functional copy of this gene exhibit impaired genome integrity and enhanced susceptibility to oxidative damage. Mutations in this gene that impair enzyme activity may be associated with prostate cancer in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene that results in a truncated transcript results in a higher rate of spontaneous germline expanded simple tandem repeat mutations. Homozyogus null mice exhibit normal immunoglobulin gene somatic hypermutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,838 S1624P probably benign Het
4930562C15Rik T A 16: 4,849,749 S335T unknown Het
4933421I07Rik T A 7: 42,448,031 H13L possibly damaging Het
6030468B19Rik A G 11: 117,806,008 T185A probably benign Het
Abcc1 T A 16: 14,410,771 V294E probably benign Het
Abhd16b A G 2: 181,493,460 T52A possibly damaging Het
Actl7a A T 4: 56,743,632 N53I probably benign Het
Ankmy1 T C 1: 92,886,723 E354G probably benign Het
Arap1 T C 7: 101,404,367 F1301S probably damaging Het
Arfgef1 A T 1: 10,153,733 W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 63,100,408 probably benign Het
BC067074 A T 13: 113,368,336 N2000Y possibly damaging Het
Ccl24 T A 5: 135,572,957 T6S possibly damaging Het
Cep152 G T 2: 125,568,892 P1292Q possibly damaging Het
Cfap46 T C 7: 139,659,815 probably benign Het
Chd6 A T 2: 160,949,557 S2627T probably damaging Het
Chd8 A T 14: 52,231,506 S552T probably damaging Het
Ciita C A 16: 10,511,366 L502M probably damaging Het
Clic1 T C 17: 35,052,487 F31S probably damaging Het
Cntnap1 T A 11: 101,178,072 I147N possibly damaging Het
Crispld1 T A 1: 17,749,607 D276E probably benign Het
Cspg4 A T 9: 56,885,808 N276Y probably damaging Het
Cwf19l2 A G 9: 3,410,035 M55V possibly damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dopey2 T C 16: 93,757,081 I301T probably damaging Het
Epg5 T C 18: 77,991,365 V1443A probably benign Het
Ephb4 T C 5: 137,365,702 V612A probably benign Het
Fcgbp T A 7: 28,094,937 C1189S probably damaging Het
Fgfr2 T G 7: 130,185,193 probably benign Het
Fmn2 A G 1: 174,609,895 E1144G probably damaging Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 T11A probably damaging Het
Ghdc G T 11: 100,770,103 Q79K possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Heg1 T G 16: 33,719,772 D367E probably benign Het
Igkv13-84 C T 6: 68,939,910 P64S probably damaging Het
Il10rb T A 16: 91,414,657 S128T possibly damaging Het
Il15ra T A 2: 11,718,306 I47N probably damaging Het
Il33 C A 19: 29,958,911 S207* probably null Het
Itgb7 A G 15: 102,224,413 Y155H possibly damaging Het
Kdm5a A G 6: 120,369,099 probably benign Het
Kif11 G A 19: 37,417,949 V987I probably benign Het
Krtap19-2 G A 16: 88,873,874 probably benign Het
Krtap24-1 T A 16: 88,611,529 R236S probably damaging Het
L3mbtl2 A G 15: 81,682,612 I406V probably benign Het
Lrp2 A T 2: 69,459,715 H3593Q possibly damaging Het
Mavs G T 2: 131,240,365 W56C probably damaging Het
Mn1 C T 5: 111,419,660 P499S probably damaging Het
Ntn5 T A 7: 45,691,471 C178S probably damaging Het
Nufip2 A G 11: 77,686,328 H34R unknown Het
Olfr470 T A 7: 107,845,548 M62L possibly damaging Het
Olfr523 T A 7: 140,176,450 L110Q probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pnpla6 T C 8: 3,522,838 V345A probably benign Het
Polr3k A G 2: 181,864,547 Y30C probably damaging Het
Pramel6 A G 2: 87,509,597 H235R probably benign Het
Ptpra G A 2: 130,537,617 V364I probably damaging Het
Recql A G 6: 142,363,700 probably benign Het
Ring1 T C 17: 34,022,289 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 C A 16: 75,947,289 noncoding transcript Het
Scara5 A G 14: 65,730,749 H157R probably benign Het
Sdc3 C T 4: 130,819,065 P245L probably damaging Het
Slc18b1 T A 10: 23,820,869 M318K possibly damaging Het
Slc26a10 C T 10: 127,173,355 A638T possibly damaging Het
Slc35f2 T A 9: 53,809,729 W259R possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Sptlc3 A G 2: 139,589,589 T344A probably benign Het
Tap1 T C 17: 34,193,891 V560A probably damaging Het
Tbc1d1 T C 5: 64,278,046 probably null Het
Tlr11 A G 14: 50,361,250 Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 S230T possibly damaging Het
Tnnt3 C T 7: 142,514,283 probably benign Het
Traf7 C G 17: 24,510,438 probably benign Het
Tshz2 A G 2: 169,962,681 probably benign Het
Tshz3 T C 7: 36,768,972 S129P probably damaging Het
Ttc6 A T 12: 57,729,451 N1727I probably damaging Het
Ttc7b A G 12: 100,403,362 S383P probably damaging Het
Tulp3 T A 6: 128,323,120 I448F probably damaging Het
Ube3b T C 5: 114,404,717 probably null Het
Vav1 G A 17: 57,296,552 V84I probably damaging Het
Vav3 A T 3: 109,508,794 K243I possibly damaging Het
Vmn1r25 T A 6: 57,979,026 I93F probably damaging Het
Vmn2r73 C T 7: 85,871,715 W348* probably null Het
Zdbf2 A G 1: 63,303,238 R259G possibly damaging Het
Other mutations in Polk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Polk APN 13 96496760 missense probably benign 0.25
IGL01803:Polk APN 13 96504522 missense probably damaging 1.00
IGL01949:Polk APN 13 96483538 missense probably benign 0.10
IGL01986:Polk APN 13 96483823 missense probably benign 0.09
IGL02073:Polk APN 13 96504551 missense probably damaging 1.00
IGL03165:Polk APN 13 96516688 missense probably benign 0.23
IGL03184:Polk APN 13 96483983 missense probably benign 0.04
IGL03353:Polk APN 13 96489211 missense probably damaging 1.00
R0019:Polk UTSW 13 96504616 missense probably damaging 1.00
R0029:Polk UTSW 13 96516670 missense probably damaging 1.00
R0200:Polk UTSW 13 96496822 missense probably benign 0.11
R0357:Polk UTSW 13 96504597 missense probably damaging 0.99
R0485:Polk UTSW 13 96483764 missense probably benign 0.05
R0555:Polk UTSW 13 96484179 missense probably damaging 0.97
R0687:Polk UTSW 13 96484017 missense probably damaging 1.00
R0980:Polk UTSW 13 96483764 missense probably benign 0.05
R1065:Polk UTSW 13 96508252 missense probably damaging 1.00
R1396:Polk UTSW 13 96484208 missense probably benign 0.02
R1710:Polk UTSW 13 96489204 missense probably damaging 1.00
R1770:Polk UTSW 13 96495442 missense probably damaging 1.00
R1789:Polk UTSW 13 96496632 missense probably damaging 1.00
R1977:Polk UTSW 13 96489228 missense probably damaging 1.00
R2301:Polk UTSW 13 96484144 missense probably benign 0.09
R3797:Polk UTSW 13 96486982 splice site probably benign
R3934:Polk UTSW 13 96501635 missense possibly damaging 0.56
R4082:Polk UTSW 13 96483673 missense probably benign 0.17
R4307:Polk UTSW 13 96496666 missense possibly damaging 0.79
R4472:Polk UTSW 13 96493905 missense probably damaging 1.00
R4795:Polk UTSW 13 96489256 missense probably benign 0.01
R4796:Polk UTSW 13 96489256 missense probably benign 0.01
R4810:Polk UTSW 13 96483495 missense possibly damaging 0.90
R5002:Polk UTSW 13 96489244 missense probably damaging 1.00
R5271:Polk UTSW 13 96483539 missense probably benign 0.09
R5415:Polk UTSW 13 96483955 missense probably benign
R5459:Polk UTSW 13 96495476 missense probably damaging 1.00
R5535:Polk UTSW 13 96495497 missense probably damaging 1.00
R5619:Polk UTSW 13 96483556 missense probably damaging 1.00
R5757:Polk UTSW 13 96484252 missense probably benign 0.03
R5801:Polk UTSW 13 96483586 missense probably damaging 1.00
R5923:Polk UTSW 13 96495415 missense probably damaging 1.00
R6365:Polk UTSW 13 96484009 missense probably damaging 1.00
R6670:Polk UTSW 13 96496630 nonsense probably null
R6831:Polk UTSW 13 96495491 missense possibly damaging 0.87
R6932:Polk UTSW 13 96516681 missense probably damaging 1.00
R7216:Polk UTSW 13 96508220 missense probably benign 0.32
R7654:Polk UTSW 13 96496813 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCAGATGGTCTTAGGTTGCTAC -3'
(R):5'- TTTTGGAACATCAGCTGAGGAAG -3'

Sequencing Primer
(F):5'- GTCTTAGGTTGCTACAAGTTGATC -3'
(R):5'- GTGGTAAAGGAAATTCGCTTCAG -3'
Posted On2015-12-29