Incidental Mutation 'R4779:Abcc1'
ID368185
Institutional Source Beutler Lab
Gene Symbol Abcc1
Ensembl Gene ENSMUSG00000023088
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 1
SynonymsMrp1, Mdrap, MRP, Abcc1b, Abcc1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R4779 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location14361558-14475737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14410771 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 294 (V294E)
Ref Sequence ENSEMBL: ENSMUSP00000115627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100167] [ENSMUST00000130671] [ENSMUST00000133454] [ENSMUST00000147759]
Predicted Effect probably benign
Transcript: ENSMUST00000100167
AA Change: V294E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097743
Gene: ENSMUSG00000023088
AA Change: V294E

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 7.8e-44 PFAM
AAA 670 845 4.07e-8 SMART
Pfam:ABC_membrane 971 1243 3e-52 PFAM
AAA 1316 1501 5.8e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130671
AA Change: V294E

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116714
Gene: ENSMUSG00000023088
AA Change: V294E

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133454
AA Change: V294E

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122656
Gene: ENSMUSG00000023088
AA Change: V294E

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147759
AA Change: V294E

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115627
Gene: ENSMUSG00000023088
AA Change: V294E

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156089
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein plays an essential role in the defense against toxic compounds and serves as the major high-affinity transporter of leukotriene C4. The encoded protein may also play an essential role in steroid hormone homeostasis as a transporter for steroid hormones and their metabolites. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have a reduced response to inflammatory stimulus, increased levels of glutathione due to impaired metabolism, and are hypersensitive to the anticancer drug etoposide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,838 S1624P probably benign Het
4930562C15Rik T A 16: 4,849,749 S335T unknown Het
4933421I07Rik T A 7: 42,448,031 H13L possibly damaging Het
6030468B19Rik A G 11: 117,806,008 T185A probably benign Het
Abhd16b A G 2: 181,493,460 T52A possibly damaging Het
Actl7a A T 4: 56,743,632 N53I probably benign Het
Ankmy1 T C 1: 92,886,723 E354G probably benign Het
Arap1 T C 7: 101,404,367 F1301S probably damaging Het
Arfgef1 A T 1: 10,153,733 W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 63,100,408 probably benign Het
BC067074 A T 13: 113,368,336 N2000Y possibly damaging Het
Ccl24 T A 5: 135,572,957 T6S possibly damaging Het
Cep152 G T 2: 125,568,892 P1292Q possibly damaging Het
Cfap46 T C 7: 139,659,815 probably benign Het
Chd6 A T 2: 160,949,557 S2627T probably damaging Het
Chd8 A T 14: 52,231,506 S552T probably damaging Het
Ciita C A 16: 10,511,366 L502M probably damaging Het
Clic1 T C 17: 35,052,487 F31S probably damaging Het
Cntnap1 T A 11: 101,178,072 I147N possibly damaging Het
Crispld1 T A 1: 17,749,607 D276E probably benign Het
Cspg4 A T 9: 56,885,808 N276Y probably damaging Het
Cwf19l2 A G 9: 3,410,035 M55V possibly damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dopey2 T C 16: 93,757,081 I301T probably damaging Het
Epg5 T C 18: 77,991,365 V1443A probably benign Het
Ephb4 T C 5: 137,365,702 V612A probably benign Het
Fcgbp T A 7: 28,094,937 C1189S probably damaging Het
Fgfr2 T G 7: 130,185,193 probably benign Het
Fmn2 A G 1: 174,609,895 E1144G probably damaging Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 T11A probably damaging Het
Ghdc G T 11: 100,770,103 Q79K possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Heg1 T G 16: 33,719,772 D367E probably benign Het
Igkv13-84 C T 6: 68,939,910 P64S probably damaging Het
Il10rb T A 16: 91,414,657 S128T possibly damaging Het
Il15ra T A 2: 11,718,306 I47N probably damaging Het
Il33 C A 19: 29,958,911 S207* probably null Het
Itgb7 A G 15: 102,224,413 Y155H possibly damaging Het
Kdm5a A G 6: 120,369,099 probably benign Het
Kif11 G A 19: 37,417,949 V987I probably benign Het
Krtap19-2 G A 16: 88,873,874 probably benign Het
Krtap24-1 T A 16: 88,611,529 R236S probably damaging Het
L3mbtl2 A G 15: 81,682,612 I406V probably benign Het
Lrp2 A T 2: 69,459,715 H3593Q possibly damaging Het
Mavs G T 2: 131,240,365 W56C probably damaging Het
Mn1 C T 5: 111,419,660 P499S probably damaging Het
Ntn5 T A 7: 45,691,471 C178S probably damaging Het
Nufip2 A G 11: 77,686,328 H34R unknown Het
Olfr470 T A 7: 107,845,548 M62L possibly damaging Het
Olfr523 T A 7: 140,176,450 L110Q probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pnpla6 T C 8: 3,522,838 V345A probably benign Het
Polk A G 13: 96,496,491 probably null Het
Polr3k A G 2: 181,864,547 Y30C probably damaging Het
Pramel6 A G 2: 87,509,597 H235R probably benign Het
Ptpra G A 2: 130,537,617 V364I probably damaging Het
Recql A G 6: 142,363,700 probably benign Het
Ring1 T C 17: 34,022,289 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 C A 16: 75,947,289 noncoding transcript Het
Scara5 A G 14: 65,730,749 H157R probably benign Het
Sdc3 C T 4: 130,819,065 P245L probably damaging Het
Slc18b1 T A 10: 23,820,869 M318K possibly damaging Het
Slc26a10 C T 10: 127,173,355 A638T possibly damaging Het
Slc35f2 T A 9: 53,809,729 W259R possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Sptlc3 A G 2: 139,589,589 T344A probably benign Het
Tap1 T C 17: 34,193,891 V560A probably damaging Het
Tbc1d1 T C 5: 64,278,046 probably null Het
Tlr11 A G 14: 50,361,250 Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 S230T possibly damaging Het
Tnnt3 C T 7: 142,514,283 probably benign Het
Traf7 C G 17: 24,510,438 probably benign Het
Tshz2 A G 2: 169,962,681 probably benign Het
Tshz3 T C 7: 36,768,972 S129P probably damaging Het
Ttc6 A T 12: 57,729,451 N1727I probably damaging Het
Ttc7b A G 12: 100,403,362 S383P probably damaging Het
Tulp3 T A 6: 128,323,120 I448F probably damaging Het
Ube3b T C 5: 114,404,717 probably null Het
Vav1 G A 17: 57,296,552 V84I probably damaging Het
Vav3 A T 3: 109,508,794 K243I possibly damaging Het
Vmn1r25 T A 6: 57,979,026 I93F probably damaging Het
Vmn2r73 C T 7: 85,871,715 W348* probably null Het
Zdbf2 A G 1: 63,303,238 R259G possibly damaging Het
Other mutations in Abcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abcc1 APN 16 14460983 missense probably benign 0.34
IGL00094:Abcc1 APN 16 14470534 missense probably null 0.00
IGL00475:Abcc1 APN 16 14436573 missense probably damaging 1.00
IGL00516:Abcc1 APN 16 14413312 nonsense probably null
IGL00765:Abcc1 APN 16 14411508 missense probably damaging 0.99
IGL00792:Abcc1 APN 16 14410926 missense probably benign 0.18
IGL01678:Abcc1 APN 16 14405019 missense probably null 0.96
IGL01683:Abcc1 APN 16 14396424 missense probably damaging 1.00
IGL01955:Abcc1 APN 16 14410795 missense probably damaging 1.00
IGL02048:Abcc1 APN 16 14411519 missense probably damaging 0.98
IGL02345:Abcc1 APN 16 14396351 missense possibly damaging 0.95
IGL02366:Abcc1 APN 16 14467979 splice site probably benign
IGL02431:Abcc1 APN 16 14419734 missense probably damaging 1.00
IGL02480:Abcc1 APN 16 14404005 missense possibly damaging 0.87
IGL02651:Abcc1 APN 16 14466126 missense probably benign 0.00
IGL02902:Abcc1 APN 16 14423127 missense probably damaging 1.00
IGL03101:Abcc1 APN 16 14389868 missense probably damaging 1.00
IGL03230:Abcc1 APN 16 14457947 missense probably benign
IGL03308:Abcc1 APN 16 14470611 missense possibly damaging 0.55
PIT4544001:Abcc1 UTSW 16 14405079 missense probably damaging 1.00
R0310:Abcc1 UTSW 16 14410927 missense probably damaging 0.98
R0594:Abcc1 UTSW 16 14389880 missense probably benign 0.05
R0894:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R0928:Abcc1 UTSW 16 14389985 critical splice donor site probably null
R1367:Abcc1 UTSW 16 14443386 missense probably damaging 1.00
R1496:Abcc1 UTSW 16 14448434 missense probably damaging 1.00
R1643:Abcc1 UTSW 16 14413368 missense probably damaging 1.00
R1795:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R1834:Abcc1 UTSW 16 14423117 missense possibly damaging 0.88
R1847:Abcc1 UTSW 16 14445449 missense probably benign 0.02
R1959:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R1961:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R2017:Abcc1 UTSW 16 14461204 missense probably damaging 1.00
R2224:Abcc1 UTSW 16 14472068 missense probably damaging 1.00
R2377:Abcc1 UTSW 16 14467923 missense probably damaging 0.97
R2513:Abcc1 UTSW 16 14473009 splice site probably null
R2876:Abcc1 UTSW 16 14457960 missense probably benign
R3003:Abcc1 UTSW 16 14436529 missense probably damaging 1.00
R3941:Abcc1 UTSW 16 14396399 missense probably benign 0.00
R4119:Abcc1 UTSW 16 14394013 missense probably benign 0.43
R4191:Abcc1 UTSW 16 14389864 missense probably damaging 1.00
R4369:Abcc1 UTSW 16 14460993 missense possibly damaging 0.88
R4428:Abcc1 UTSW 16 14445300 missense probably damaging 0.97
R4589:Abcc1 UTSW 16 14394031 missense probably benign 0.00
R5027:Abcc1 UTSW 16 14404053 critical splice donor site probably null
R5275:Abcc1 UTSW 16 14466186 missense probably damaging 1.00
R5418:Abcc1 UTSW 16 14461132 missense probably benign 0.02
R5490:Abcc1 UTSW 16 14410917 missense probably damaging 1.00
R5527:Abcc1 UTSW 16 14460978 missense probably benign 0.18
R5641:Abcc1 UTSW 16 14472013 missense probably benign 0.00
R5642:Abcc1 UTSW 16 14443455 missense probably damaging 1.00
R5875:Abcc1 UTSW 16 14467037 missense possibly damaging 0.94
R5916:Abcc1 UTSW 16 14465142 missense possibly damaging 0.95
R6112:Abcc1 UTSW 16 14460916 missense probably damaging 1.00
R6331:Abcc1 UTSW 16 14465056 missense probably damaging 0.97
R6464:Abcc1 UTSW 16 14447490 missense probably damaging 1.00
R6950:Abcc1 UTSW 16 14411616 missense probably damaging 1.00
R7024:Abcc1 UTSW 16 14413383 critical splice donor site probably null
R7115:Abcc1 UTSW 16 14437725 missense probably benign 0.11
R7187:Abcc1 UTSW 16 14466997 missense probably benign
R7298:Abcc1 UTSW 16 14396472 missense possibly damaging 0.89
R7342:Abcc1 UTSW 16 14465169 missense probably damaging 0.99
R7474:Abcc1 UTSW 16 14472986 missense possibly damaging 0.95
R7488:Abcc1 UTSW 16 14389899 nonsense probably null
R7583:Abcc1 UTSW 16 14404038 missense probably damaging 1.00
R7619:Abcc1 UTSW 16 14445419 missense probably damaging 0.96
R7971:Abcc1 UTSW 16 14448579 missense probably benign
R8048:Abcc1 UTSW 16 14410844 missense probably damaging 1.00
R8138:Abcc1 UTSW 16 14472887 missense probably damaging 0.99
R8159:Abcc1 UTSW 16 14472930 missense probably damaging 0.96
R8319:Abcc1 UTSW 16 14396451 missense probably damaging 1.00
X0026:Abcc1 UTSW 16 14459902 missense possibly damaging 0.94
Z1088:Abcc1 UTSW 16 14410809 missense probably benign 0.01
Z1177:Abcc1 UTSW 16 14411493 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTAAGCTTGACTCTATGGTG -3'
(R):5'- ACCAGGTTCTTACTCCAAGATC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- ATCTTGGGGCCGGCAAAC -3'
Posted On2015-12-29