Incidental Mutation 'R4779:Ring1'
ID 368194
Institutional Source Beutler Lab
Gene Symbol Ring1
Ensembl Gene ENSMUSG00000024325
Gene Name ring finger protein 1
Synonyms Ring1A
MMRRC Submission 045240-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.723) question?
Stock # R4779 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34239766-34243654 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 34241263 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025183] [ENSMUST00000045467] [ENSMUST00000114303]
AlphaFold O35730
Predicted Effect probably benign
Transcript: ENSMUST00000025183
SMART Domains Protein: ENSMUSP00000025183
Gene: ENSMUSG00000024325

DomainStartEndE-ValueType
RING 48 87 7.92e-8 SMART
low complexity region 171 229 N/A INTRINSIC
low complexity region 236 261 N/A INTRINSIC
Pfam:RAWUL 272 400 4.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045467
SMART Domains Protein: ENSMUSP00000038069
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 201 1.5e-16 PFAM
Pfam:adh_short 10 213 4.5e-52 PFAM
Pfam:adh_short_C2 16 258 8.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083621
Predicted Effect probably benign
Transcript: ENSMUST00000114303
SMART Domains Protein: ENSMUSP00000133546
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 202 5.5e-16 PFAM
Pfam:adh_short 22 193 2.7e-30 PFAM
Pfam:adh_short_C2 23 234 1.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173894
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the RING finger family, members of which encode proteins characterized by a RING domain, a zinc-binding motif related to the zinc finger domain. The gene product can bind DNA and can act as a transcriptional repressor. It is associated with the multimeric polycomb group protein complex. The gene product interacts with the polycomb group proteins BMI1, EDR1, and CBX4, and colocalizes with these proteins in large nuclear domains. It interacts with the CBX4 protein via its glycine-rich C-terminal domain. The gene maps to the HLA class II region, where it is contiguous with the RING finger genes FABGL and HKE4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both homozygous and heterozygous mutant mice show axial skeleton defects including anterior transformations of vertebrae and rib abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,667,613 (GRCm39) S335T unknown Het
4933421I07Rik T A 7: 42,097,455 (GRCm39) H13L possibly damaging Het
6030468B19Rik A G 11: 117,696,834 (GRCm39) T185A probably benign Het
Abcc1 T A 16: 14,228,635 (GRCm39) V294E probably benign Het
Abhd16b A G 2: 181,135,253 (GRCm39) T52A possibly damaging Het
Actl7a A T 4: 56,743,632 (GRCm39) N53I probably benign Het
Ankmy1 T C 1: 92,814,445 (GRCm39) E354G probably benign Het
Arap1 T C 7: 101,053,574 (GRCm39) F1301S probably damaging Het
Arfgef1 A T 1: 10,223,958 (GRCm39) W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 62,936,187 (GRCm39) probably benign Het
Ccl24 T A 5: 135,601,811 (GRCm39) T6S possibly damaging Het
Cep152 G T 2: 125,410,812 (GRCm39) P1292Q possibly damaging Het
Cfap46 T C 7: 139,239,731 (GRCm39) probably benign Het
Chd6 A T 2: 160,791,477 (GRCm39) S2627T probably damaging Het
Chd8 A T 14: 52,468,963 (GRCm39) S552T probably damaging Het
Ciita C A 16: 10,329,230 (GRCm39) L502M probably damaging Het
Clic1 T C 17: 35,271,463 (GRCm39) F31S probably damaging Het
Cntnap1 T A 11: 101,068,898 (GRCm39) I147N possibly damaging Het
Cplane1 T C 15: 8,248,322 (GRCm39) S1624P probably benign Het
Crispld1 T A 1: 17,819,831 (GRCm39) D276E probably benign Het
Cspg4 A T 9: 56,793,092 (GRCm39) N276Y probably damaging Het
Cspg4b A T 13: 113,504,870 (GRCm39) N2000Y possibly damaging Het
Cwf19l2 A G 9: 3,410,035 (GRCm39) M55V possibly damaging Het
Cyp2c69 T C 19: 39,866,038 (GRCm39) N185S probably benign Het
Dop1b T C 16: 93,553,969 (GRCm39) I301T probably damaging Het
Epg5 T C 18: 78,034,580 (GRCm39) V1443A probably benign Het
Ephb4 T C 5: 137,363,964 (GRCm39) V612A probably benign Het
Fcgbp T A 7: 27,794,362 (GRCm39) C1189S probably damaging Het
Fgfr2 T G 7: 129,786,923 (GRCm39) probably benign Het
Fmn2 A G 1: 174,437,461 (GRCm39) E1144G probably damaging Het
Fmo3 T C 1: 162,796,407 (GRCm39) Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 (GRCm39) T11A probably damaging Het
Ghdc G T 11: 100,660,929 (GRCm39) Q79K possibly damaging Het
Gm11677 C T 11: 111,615,537 (GRCm39) noncoding transcript Het
Gm5591 T C 7: 38,221,680 (GRCm39) T130A probably damaging Het
Heg1 T G 16: 33,540,142 (GRCm39) D367E probably benign Het
Igkv13-84 C T 6: 68,916,894 (GRCm39) P64S probably damaging Het
Il10rb T A 16: 91,211,545 (GRCm39) S128T possibly damaging Het
Il15ra T A 2: 11,723,117 (GRCm39) I47N probably damaging Het
Il33 C A 19: 29,936,311 (GRCm39) S207* probably null Het
Itgb7 A G 15: 102,132,848 (GRCm39) Y155H possibly damaging Het
Kdm5a A G 6: 120,346,060 (GRCm39) probably benign Het
Kif11 G A 19: 37,406,397 (GRCm39) V987I probably benign Het
Krtap19-2 G A 16: 88,670,762 (GRCm39) probably benign Het
Krtap24-1 T A 16: 88,408,417 (GRCm39) R236S probably damaging Het
L3mbtl2 A G 15: 81,566,813 (GRCm39) I406V probably benign Het
Lrp2 A T 2: 69,290,059 (GRCm39) H3593Q possibly damaging Het
Mavs G T 2: 131,082,285 (GRCm39) W56C probably damaging Het
Mn1 C T 5: 111,567,526 (GRCm39) P499S probably damaging Het
Ntn5 T A 7: 45,340,895 (GRCm39) C178S probably damaging Het
Nufip2 A G 11: 77,577,154 (GRCm39) H34R unknown Het
Or5p51 T A 7: 107,444,755 (GRCm39) M62L possibly damaging Het
Or6f2 T A 7: 139,756,363 (GRCm39) L110Q probably damaging Het
Osbpl10 C T 9: 114,938,598 (GRCm39) S86L probably damaging Het
Pitpna T A 11: 75,511,153 (GRCm39) M242K possibly damaging Het
Pnpla6 T C 8: 3,572,838 (GRCm39) V345A probably benign Het
Polk A G 13: 96,632,999 (GRCm39) probably null Het
Polr3k A G 2: 181,506,340 (GRCm39) Y30C probably damaging Het
Pramel6 A G 2: 87,339,941 (GRCm39) H235R probably benign Het
Ptpra G A 2: 130,379,537 (GRCm39) V364I probably damaging Het
Recql A G 6: 142,309,426 (GRCm39) probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Samsn1 C A 16: 75,744,177 (GRCm39) noncoding transcript Het
Scara5 A G 14: 65,968,198 (GRCm39) H157R probably benign Het
Sdc3 C T 4: 130,546,376 (GRCm39) P245L probably damaging Het
Slc18b1 T A 10: 23,696,767 (GRCm39) M318K possibly damaging Het
Slc26a10 C T 10: 127,009,224 (GRCm39) A638T possibly damaging Het
Slc35f2 T A 9: 53,717,013 (GRCm39) W259R possibly damaging Het
Spata13 G A 14: 60,991,356 (GRCm39) W366* probably null Het
Sptlc3 A G 2: 139,431,509 (GRCm39) T344A probably benign Het
Tap1 T C 17: 34,412,865 (GRCm39) V560A probably damaging Het
Tbc1d1 T C 5: 64,435,389 (GRCm39) probably null Het
Tlr11 A G 14: 50,598,707 (GRCm39) Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 (GRCm39) S230T possibly damaging Het
Tnnt3 C T 7: 142,068,020 (GRCm39) probably benign Het
Traf7 C G 17: 24,729,412 (GRCm39) probably benign Het
Tshz2 A G 2: 169,804,601 (GRCm39) probably benign Het
Tshz3 T C 7: 36,468,397 (GRCm39) S129P probably damaging Het
Ttc6 A T 12: 57,776,237 (GRCm39) N1727I probably damaging Het
Ttc7b A G 12: 100,369,621 (GRCm39) S383P probably damaging Het
Tulp3 T A 6: 128,300,083 (GRCm39) I448F probably damaging Het
Ube3b T C 5: 114,542,778 (GRCm39) probably null Het
Vav1 G A 17: 57,603,552 (GRCm39) V84I probably damaging Het
Vav3 A T 3: 109,416,110 (GRCm39) K243I possibly damaging Het
Vmn1r25 T A 6: 57,956,011 (GRCm39) I93F probably damaging Het
Vmn2r73 C T 7: 85,520,923 (GRCm39) W348* probably null Het
Zdbf2 A G 1: 63,342,397 (GRCm39) R259G possibly damaging Het
Other mutations in Ring1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ring1 APN 17 34,241,983 (GRCm39) missense possibly damaging 0.89
IGL01734:Ring1 APN 17 34,242,294 (GRCm39) missense probably damaging 1.00
IGL02420:Ring1 APN 17 34,242,122 (GRCm39) missense possibly damaging 0.67
R4711:Ring1 UTSW 17 34,241,333 (GRCm39) missense possibly damaging 0.72
R4762:Ring1 UTSW 17 34,240,971 (GRCm39) unclassified probably benign
R4770:Ring1 UTSW 17 34,242,361 (GRCm39) missense probably damaging 1.00
R4935:Ring1 UTSW 17 34,242,016 (GRCm39) missense probably benign 0.04
R5561:Ring1 UTSW 17 34,240,432 (GRCm39) missense possibly damaging 0.85
R5772:Ring1 UTSW 17 34,241,282 (GRCm39) missense possibly damaging 0.96
R6235:Ring1 UTSW 17 34,242,280 (GRCm39) missense probably damaging 0.98
R7060:Ring1 UTSW 17 34,242,364 (GRCm39) missense probably damaging 1.00
R7115:Ring1 UTSW 17 34,242,420 (GRCm39) missense probably damaging 0.97
R7363:Ring1 UTSW 17 34,243,336 (GRCm39) missense possibly damaging 0.68
R7380:Ring1 UTSW 17 34,240,694 (GRCm39) missense probably damaging 0.98
R7556:Ring1 UTSW 17 34,240,688 (GRCm39) missense possibly damaging 0.52
R7703:Ring1 UTSW 17 34,242,109 (GRCm39) missense probably damaging 1.00
R9289:Ring1 UTSW 17 34,241,547 (GRCm39) missense possibly damaging 0.73
R9716:Ring1 UTSW 17 34,240,420 (GRCm39) missense possibly damaging 0.85
Z1177:Ring1 UTSW 17 34,240,752 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAAAAGTTCTGGCTGGG -3'
(R):5'- GTTCTGAAGACTCTGGTGACC -3'

Sequencing Primer
(F):5'- CTCTGGGAATGACAGGTGTACACTAC -3'
(R):5'- ACTCTGGTGACCGGGGC -3'
Posted On 2015-12-29