Incidental Mutation 'R4779:Il33'
ID368198
Institutional Source Beutler Lab
Gene Symbol Il33
Ensembl Gene ENSMUSG00000024810
Gene Nameinterleukin 33
SynonymsNF-HEV, Il-33, Il1f11, 9230117N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4779 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location29925114-29960718 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 29958911 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 207 (S207*)
Ref Sequence ENSEMBL: ENSMUSP00000135854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025724] [ENSMUST00000120388] [ENSMUST00000177518]
Predicted Effect probably null
Transcript: ENSMUST00000025724
AA Change: S224*
SMART Domains Protein: ENSMUSP00000025724
Gene: ENSMUSG00000024810
AA Change: S224*

DomainStartEndE-ValueType
Pfam:IL33 5 264 4.6e-146 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120388
AA Change: S224*
SMART Domains Protein: ENSMUSP00000113829
Gene: ENSMUSG00000024810
AA Change: S224*

DomainStartEndE-ValueType
Pfam:IL33 5 264 3.4e-129 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177518
AA Change: S207*
SMART Domains Protein: ENSMUSP00000135854
Gene: ENSMUSG00000024810
AA Change: S207*

DomainStartEndE-ValueType
Pfam:IL33 5 228 4.1e-115 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that binds to the IL1RL1/ST2 receptor. The encoded protein is involved in the maturation of Th2 cells and the activation of mast cells, basophils, eosinophils and natural killer cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Nullizygous mutations lead to altered Type 2 immunity and increased susceptibility to parasite infection. Homozygotes for a null allele show accelerated ovarian functional decline and early reproductive aging due to impaired migration of ovarian macrophages and failed disposal of atretic follicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,838 S1624P probably benign Het
4930562C15Rik T A 16: 4,849,749 S335T unknown Het
4933421I07Rik T A 7: 42,448,031 H13L possibly damaging Het
6030468B19Rik A G 11: 117,806,008 T185A probably benign Het
Abcc1 T A 16: 14,410,771 V294E probably benign Het
Abhd16b A G 2: 181,493,460 T52A possibly damaging Het
Actl7a A T 4: 56,743,632 N53I probably benign Het
Ankmy1 T C 1: 92,886,723 E354G probably benign Het
Arap1 T C 7: 101,404,367 F1301S probably damaging Het
Arfgef1 A T 1: 10,153,733 W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 63,100,408 probably benign Het
BC067074 A T 13: 113,368,336 N2000Y possibly damaging Het
Ccl24 T A 5: 135,572,957 T6S possibly damaging Het
Cep152 G T 2: 125,568,892 P1292Q possibly damaging Het
Cfap46 T C 7: 139,659,815 probably benign Het
Chd6 A T 2: 160,949,557 S2627T probably damaging Het
Chd8 A T 14: 52,231,506 S552T probably damaging Het
Ciita C A 16: 10,511,366 L502M probably damaging Het
Clic1 T C 17: 35,052,487 F31S probably damaging Het
Cntnap1 T A 11: 101,178,072 I147N possibly damaging Het
Crispld1 T A 1: 17,749,607 D276E probably benign Het
Cspg4 A T 9: 56,885,808 N276Y probably damaging Het
Cwf19l2 A G 9: 3,410,035 M55V possibly damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dopey2 T C 16: 93,757,081 I301T probably damaging Het
Epg5 T C 18: 77,991,365 V1443A probably benign Het
Ephb4 T C 5: 137,365,702 V612A probably benign Het
Fcgbp T A 7: 28,094,937 C1189S probably damaging Het
Fgfr2 T G 7: 130,185,193 probably benign Het
Fmn2 A G 1: 174,609,895 E1144G probably damaging Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 T11A probably damaging Het
Ghdc G T 11: 100,770,103 Q79K possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Heg1 T G 16: 33,719,772 D367E probably benign Het
Igkv13-84 C T 6: 68,939,910 P64S probably damaging Het
Il10rb T A 16: 91,414,657 S128T possibly damaging Het
Il15ra T A 2: 11,718,306 I47N probably damaging Het
Itgb7 A G 15: 102,224,413 Y155H possibly damaging Het
Kdm5a A G 6: 120,369,099 probably benign Het
Kif11 G A 19: 37,417,949 V987I probably benign Het
Krtap19-2 G A 16: 88,873,874 probably benign Het
Krtap24-1 T A 16: 88,611,529 R236S probably damaging Het
L3mbtl2 A G 15: 81,682,612 I406V probably benign Het
Lrp2 A T 2: 69,459,715 H3593Q possibly damaging Het
Mavs G T 2: 131,240,365 W56C probably damaging Het
Mn1 C T 5: 111,419,660 P499S probably damaging Het
Ntn5 T A 7: 45,691,471 C178S probably damaging Het
Nufip2 A G 11: 77,686,328 H34R unknown Het
Olfr470 T A 7: 107,845,548 M62L possibly damaging Het
Olfr523 T A 7: 140,176,450 L110Q probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pnpla6 T C 8: 3,522,838 V345A probably benign Het
Polk A G 13: 96,496,491 probably null Het
Polr3k A G 2: 181,864,547 Y30C probably damaging Het
Pramel6 A G 2: 87,509,597 H235R probably benign Het
Ptpra G A 2: 130,537,617 V364I probably damaging Het
Recql A G 6: 142,363,700 probably benign Het
Ring1 T C 17: 34,022,289 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 C A 16: 75,947,289 noncoding transcript Het
Scara5 A G 14: 65,730,749 H157R probably benign Het
Sdc3 C T 4: 130,819,065 P245L probably damaging Het
Slc18b1 T A 10: 23,820,869 M318K possibly damaging Het
Slc26a10 C T 10: 127,173,355 A638T possibly damaging Het
Slc35f2 T A 9: 53,809,729 W259R possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Sptlc3 A G 2: 139,589,589 T344A probably benign Het
Tap1 T C 17: 34,193,891 V560A probably damaging Het
Tbc1d1 T C 5: 64,278,046 probably null Het
Tlr11 A G 14: 50,361,250 Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 S230T possibly damaging Het
Tnnt3 C T 7: 142,514,283 probably benign Het
Traf7 C G 17: 24,510,438 probably benign Het
Tshz2 A G 2: 169,962,681 probably benign Het
Tshz3 T C 7: 36,768,972 S129P probably damaging Het
Ttc6 A T 12: 57,729,451 N1727I probably damaging Het
Ttc7b A G 12: 100,403,362 S383P probably damaging Het
Tulp3 T A 6: 128,323,120 I448F probably damaging Het
Ube3b T C 5: 114,404,717 probably null Het
Vav1 G A 17: 57,296,552 V84I probably damaging Het
Vav3 A T 3: 109,508,794 K243I possibly damaging Het
Vmn1r25 T A 6: 57,979,026 I93F probably damaging Het
Vmn2r73 C T 7: 85,871,715 W348* probably null Het
Zdbf2 A G 1: 63,303,238 R259G possibly damaging Het
Other mutations in Il33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Il33 APN 19 29952756 missense probably benign 0.00
IGL01531:Il33 APN 19 29951981 missense possibly damaging 0.71
IGL01627:Il33 APN 19 29951990 missense possibly damaging 0.95
IGL02535:Il33 APN 19 29952747 missense probably benign 0.04
lacquer UTSW 19 29951990 missense possibly damaging 0.95
PIT4504001:Il33 UTSW 19 29952739 missense probably benign 0.12
R0548:Il33 UTSW 19 29954647 missense probably benign 0.37
R0557:Il33 UTSW 19 29954636 missense probably damaging 0.98
R1511:Il33 UTSW 19 29955215 missense probably damaging 1.00
R1512:Il33 UTSW 19 29951990 missense possibly damaging 0.95
R1993:Il33 UTSW 19 29956904 missense possibly damaging 0.96
R1994:Il33 UTSW 19 29956904 missense possibly damaging 0.96
R2035:Il33 UTSW 19 29954637 missense probably damaging 0.98
R6429:Il33 UTSW 19 29952000 missense probably benign 0.16
R6498:Il33 UTSW 19 29949737 missense probably benign
R6879:Il33 UTSW 19 29958962 missense probably damaging 0.98
R7218:Il33 UTSW 19 29958925 missense probably damaging 0.99
R7571:Il33 UTSW 19 29956941 missense probably damaging 1.00
X0025:Il33 UTSW 19 29954612 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCAAGCTGCTTATCCACTC -3'
(R):5'- TGGAAGCATTAAGTCATTCAACCC -3'

Sequencing Primer
(F):5'- TCGACTCAGTACAAACTTCCTAG -3'
(R):5'- GCATTAAGTCATTCAACCCAGAACG -3'
Posted On2015-12-29