Incidental Mutation 'R0413:Fmnl1'
ID 36821
Institutional Source Beutler Lab
Gene Symbol Fmnl1
Ensembl Gene ENSMUSG00000055805
Gene Name formin-like 1
Synonyms formin-related gene in leukocytes, 8030453N10Rik
MMRRC Submission 038615-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock # R0413 (G1)
Quality Score 171
Status Validated
Chromosome 11
Chromosomal Location 103171107-103198901 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 103194063 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021323] [ENSMUST00000042286] [ENSMUST00000107026] [ENSMUST00000107027] [ENSMUST00000129726] [ENSMUST00000218163]
AlphaFold Q9JL26
Predicted Effect noncoding transcript
Transcript: ENSMUST00000021322
Predicted Effect probably benign
Transcript: ENSMUST00000021323
SMART Domains Protein: ENSMUSP00000021323
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 109 137 7.23e1 SMART
EFh 145 173 6.68e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042286
SMART Domains Protein: ENSMUSP00000046296
Gene: ENSMUSG00000055805

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
low complexity region 1074 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107026
SMART Domains Protein: ENSMUSP00000102641
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 40 68 7.23e1 SMART
EFh 76 104 6.68e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107027
SMART Domains Protein: ENSMUSP00000102642
Gene: ENSMUSG00000055805

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126425
Predicted Effect probably benign
Transcript: ENSMUST00000129726
SMART Domains Protein: ENSMUSP00000133299
Gene: ENSMUSG00000055805

DomainStartEndE-ValueType
Pfam:FH2 1 50 8.2e-10 PFAM
low complexity region 124 139 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174079
Predicted Effect probably benign
Transcript: ENSMUST00000218163
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 99% (99/100)
MGI Phenotype PHENOTYPE: Constitutive homozygous KO is embryonic lethal. Conditional homozygous KO in myeloid cells leads to reduced macrophage migration and podosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,328,011 probably benign Het
Adh1 C T 3: 138,280,432 T60I probably benign Het
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
AI464131 G T 4: 41,498,585 H348Q probably benign Het
Arih2 G T 9: 108,616,717 Q166K probably damaging Het
BC027072 T G 17: 71,752,217 D155A probably benign Het
Cacna1s A G 1: 136,098,209 T1031A probably benign Het
Ccdc102a C A 8: 94,903,286 E542D probably benign Het
Cdk1 T C 10: 69,345,099 I94V probably benign Het
Cep290 C T 10: 100,523,314 Q969* probably null Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Col12a1 T C 9: 79,699,360 T594A probably damaging Het
Cpox A G 16: 58,670,869 T148A possibly damaging Het
Csf3r A G 4: 126,039,667 probably benign Het
Csmd1 A T 8: 16,710,514 C202S probably damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dnah9 T A 11: 66,108,135 Y1029F probably damaging Het
Dok5 T C 2: 170,829,960 probably benign Het
Dusp11 A T 6: 85,952,370 probably benign Het
Edar T C 10: 58,629,440 N34D probably benign Het
Efcab7 C T 4: 99,909,746 T56I probably damaging Het
Entpd1 G A 19: 40,711,285 V47I probably benign Het
Ephx4 A G 5: 107,403,735 N62S probably benign Het
Etaa1 A T 11: 17,946,350 L589* probably null Het
Fam135b T A 15: 71,463,821 N508I probably benign Het
Fam193a T C 5: 34,466,208 V27A possibly damaging Het
Fstl1 A C 16: 37,821,154 probably null Het
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gemin4 T C 11: 76,211,322 Y871C probably benign Het
Gm7247 T C 14: 51,523,472 V166A probably benign Het
Gpcpd1 A T 2: 132,564,623 probably benign Het
Gpnmb A G 6: 49,042,803 D36G probably benign Het
Ido2 C T 8: 24,558,143 probably null Het
Igfn1 G A 1: 135,967,596 T1744I probably benign Het
Inf2 T G 12: 112,601,676 F221V probably damaging Het
Itga10 T A 3: 96,649,059 I170N probably damaging Het
Lrp6 A T 6: 134,507,624 D345E probably damaging Het
Macf1 A T 4: 123,472,269 S2900T probably benign Het
Med13 C A 11: 86,299,207 probably benign Het
Morc3 T C 16: 93,870,474 V507A probably damaging Het
Myadm AC ACC 7: 3,296,760 probably null Het
Myl6 C T 10: 128,492,222 probably benign Het
Mylk T C 16: 34,921,944 V942A probably benign Het
Ncdn G T 4: 126,750,534 T165K possibly damaging Het
Ncf1 T C 5: 134,222,802 probably benign Het
Neb T C 2: 52,290,739 probably benign Het
Nid1 T A 13: 13,482,096 I604N probably benign Het
Nsrp1 T C 11: 77,046,171 R400G probably benign Het
Nup43 T G 10: 7,671,027 I137S probably benign Het
Nynrin A G 14: 55,872,191 N1585S possibly damaging Het
Obscn T A 11: 59,002,997 Y6748F probably benign Het
Olfr1058 G A 2: 86,385,714 R235C probably benign Het
Olfr1211 A G 2: 88,929,562 V251A probably benign Het
Olfr1389 T C 11: 49,431,385 V303A possibly damaging Het
Olfr60 A T 7: 140,345,195 S265T possibly damaging Het
Olfr623 A T 7: 103,660,750 F167I possibly damaging Het
Olfr67 A G 7: 103,788,155 Y41H probably damaging Het
Olfr944 A G 9: 39,218,270 I304M probably benign Het
Olfr992 T C 2: 85,399,675 N286S probably damaging Het
Omg A G 11: 79,502,835 S66P possibly damaging Het
Ormdl1 C T 1: 53,308,819 probably benign Het
Ovch2 T A 7: 107,782,036 I552L probably benign Het
Pcsk9 G T 4: 106,454,341 T231N probably damaging Het
Pgpep1 T C 8: 70,657,450 N22S probably damaging Het
Plb1 T C 5: 32,355,362 F1355L probably damaging Het
Plcg1 G T 2: 160,761,429 L1173F probably damaging Het
Plch2 A T 4: 155,006,916 probably null Het
Ppp1r3g T A 13: 35,969,348 F250L probably damaging Het
Prkcg A G 7: 3,319,579 I381V probably benign Het
Pum2 C T 12: 8,713,464 A207V probably benign Het
Rabac1 T C 7: 24,970,182 E166G probably damaging Het
Rad21l G A 2: 151,651,931 S450L probably benign Het
Rangap1 ACACTCA ACA 15: 81,716,675 probably null Het
Reg3b G T 6: 78,371,841 C40F probably damaging Het
Rfx2 A G 17: 56,784,418 probably benign Het
Rrp15 G A 1: 186,749,149 probably benign Het
Schip1 G T 3: 68,494,613 G36C probably damaging Het
Sec61a2 A T 2: 5,876,354 probably benign Het
Sema5a A G 15: 32,669,444 K705E probably damaging Het
Setx A G 2: 29,139,278 Y186C probably damaging Het
Slc22a23 T C 13: 34,183,132 E631G probably damaging Het
Slc5a5 T C 8: 70,891,675 T134A possibly damaging Het
Stx7 T C 10: 24,181,594 S173P probably damaging Het
Sybu T C 15: 44,673,272 T353A probably damaging Het
Syde2 T A 3: 146,007,132 N1008K probably damaging Het
Tiam1 T C 16: 89,809,365 probably benign Het
Timm10b G A 7: 105,678,330 E61K probably benign Het
Tm2d1 A G 4: 98,365,573 I121T probably damaging Het
Trim75 T C 8: 64,983,240 E186G probably benign Het
Tti1 T C 2: 157,995,476 K895E probably benign Het
Vmn1r43 A G 6: 89,869,848 S219P probably damaging Het
Vmn2r73 A T 7: 85,871,879 S294T possibly damaging Het
Vmn2r94 A T 17: 18,243,818 F737I probably damaging Het
Vsx2 A T 12: 84,570,003 T21S probably benign Het
Wrb T G 16: 96,153,017 S105R probably benign Het
Zfp462 G T 4: 55,010,534 R833S probably damaging Het
Zfpl1 G A 19: 6,082,452 P143L probably damaging Het
Other mutations in Fmnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Fmnl1 APN 11 103197340 nonsense probably null
IGL00972:Fmnl1 APN 11 103180955 missense probably damaging 1.00
IGL01406:Fmnl1 APN 11 103194690 unclassified probably benign
IGL01417:Fmnl1 APN 11 103196694 unclassified probably benign
IGL01599:Fmnl1 APN 11 103186656 missense probably damaging 1.00
IGL02151:Fmnl1 APN 11 103192772 missense probably benign 0.38
IGL02324:Fmnl1 APN 11 103179538 missense probably damaging 1.00
IGL02812:Fmnl1 APN 11 103196766 unclassified probably benign
IGL03369:Fmnl1 APN 11 103197182 splice site probably null
archetypal UTSW 11 103186627 missense probably damaging 1.00
contractual UTSW 11 103180915 missense probably damaging 1.00
stylistic UTSW 11 103193736 critical splice donor site probably null
R0077:Fmnl1 UTSW 11 103189969 missense probably damaging 1.00
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R1170:Fmnl1 UTSW 11 103197370 missense probably benign 0.02
R1389:Fmnl1 UTSW 11 103186709 splice site probably null
R1794:Fmnl1 UTSW 11 103197147 missense probably benign 0.00
R2082:Fmnl1 UTSW 11 103192025 missense probably damaging 1.00
R2105:Fmnl1 UTSW 11 103194692 missense probably benign 0.39
R3611:Fmnl1 UTSW 11 103194765 unclassified probably benign
R3883:Fmnl1 UTSW 11 103182114 missense probably damaging 1.00
R3893:Fmnl1 UTSW 11 103196757 unclassified probably benign
R4658:Fmnl1 UTSW 11 103197694 missense probably damaging 1.00
R4689:Fmnl1 UTSW 11 103193736 critical splice donor site probably null
R4812:Fmnl1 UTSW 11 103198564 unclassified probably benign
R4996:Fmnl1 UTSW 11 103182656 missense possibly damaging 0.58
R5646:Fmnl1 UTSW 11 103196512 unclassified probably benign
R5702:Fmnl1 UTSW 11 103185665 missense probably damaging 1.00
R5850:Fmnl1 UTSW 11 103195285 unclassified probably benign
R5903:Fmnl1 UTSW 11 103171444 splice site probably null
R6254:Fmnl1 UTSW 11 103196315 unclassified probably benign
R6958:Fmnl1 UTSW 11 103171314 start codon destroyed probably null 1.00
R7030:Fmnl1 UTSW 11 103194774 unclassified probably benign
R7133:Fmnl1 UTSW 11 103181784 critical splice donor site probably null
R7171:Fmnl1 UTSW 11 103190398 missense probably damaging 1.00
R7224:Fmnl1 UTSW 11 103182769 critical splice donor site probably null
R7282:Fmnl1 UTSW 11 103196265 missense unknown
R7448:Fmnl1 UTSW 11 103186627 missense probably damaging 1.00
R7463:Fmnl1 UTSW 11 103193128 missense probably damaging 1.00
R7831:Fmnl1 UTSW 11 103198173 missense unknown
R7862:Fmnl1 UTSW 11 103180930 missense probably damaging 1.00
R7973:Fmnl1 UTSW 11 103171158 start gained probably benign
R8177:Fmnl1 UTSW 11 103189959 missense probably damaging 0.98
R8273:Fmnl1 UTSW 11 103186699 missense probably damaging 1.00
R8345:Fmnl1 UTSW 11 103186614 missense possibly damaging 0.88
R8507:Fmnl1 UTSW 11 103194033 missense unknown
R8921:Fmnl1 UTSW 11 103197141 missense unknown
R8946:Fmnl1 UTSW 11 103180915 missense probably damaging 1.00
R8968:Fmnl1 UTSW 11 103186618 small deletion probably benign
R9114:Fmnl1 UTSW 11 103196501 missense unknown
R9696:Fmnl1 UTSW 11 103195471 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAAGAGTCTCTATTGCCTCCTGCC -3'
(R):5'- TGAACAGTCAGCAAAGCCGTAAGC -3'

Sequencing Primer
(F):5'- GTTAGTCCCCTCCAGGGTC -3'
(R):5'- CCGTAAGCAGAGACTTATTCCAGG -3'
Posted On 2013-05-09