Incidental Mutation 'R4087:Ssfa2'
ID368219
Institutional Source Beutler Lab
Gene Symbol Ssfa2
Ensembl Gene ENSMUSG00000027007
Gene Namesperm specific antigen 2
SynonymsCS1, CS-1, SPAG13, KRAP
MMRRC Submission 040980-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.634) question?
Stock #R4087 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location79635352-79672966 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 79658347 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 925 (Q925*)
Ref Sequence ENSEMBL: ENSMUSP00000107418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111784] [ENSMUST00000111785] [ENSMUST00000111788]
Predicted Effect probably null
Transcript: ENSMUST00000111784
AA Change: Q925*
SMART Domains Protein: ENSMUSP00000107414
Gene: ENSMUSG00000027007
AA Change: Q925*

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 858 1029 7.5e-88 PFAM
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1144 1156 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111785
AA Change: Q925*
SMART Domains Protein: ENSMUSP00000107415
Gene: ENSMUSG00000027007
AA Change: Q925*

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 861 1029 8.9e-83 PFAM
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1166 1178 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111788
AA Change: Q925*
SMART Domains Protein: ENSMUSP00000107418
Gene: ENSMUSG00000027007
AA Change: Q925*

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 858 1029 7.4e-88 PFAM
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1166 1178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133266
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 96% (50/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display decreased body weight, resistance to diet induced obesity, increased food intake, decreased adipose tissue mass, elevated metabolic rate, abnormal glucose homeostasis, and abnormal hormone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,166,510 S80P probably damaging Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Col6a6 A T 9: 105,783,956 I318N possibly damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dym T A 18: 75,230,101 Y559N probably damaging Het
Eif3g A G 9: 20,897,952 V59A possibly damaging Het
Fam171a1 G A 2: 3,226,296 R697Q probably damaging Het
Fermt3 T A 19: 7,003,577 probably null Het
Git2 A G 5: 114,764,405 Y189H probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm7713 C T 15: 59,994,409 noncoding transcript Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Kcnh8 T C 17: 52,803,400 I213T possibly damaging Het
Lpgat1 A T 1: 191,763,616 I306F possibly damaging Het
Mapk8 T C 14: 33,390,248 T228A probably benign Het
Med12l T C 3: 59,297,921 V2101A probably benign Het
Mettl13 T C 1: 162,548,202 K19E possibly damaging Het
Mta1 A G 12: 113,112,182 Y22C probably damaging Het
Notch3 T C 17: 32,158,113 T273A possibly damaging Het
Notch4 T C 17: 34,584,435 W1443R probably damaging Het
Npy5r T A 8: 66,682,045 D32V probably damaging Het
Olfr1083-ps C A 2: 86,606,953 *206L probably null Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rnf144a C T 12: 26,327,592 V51I probably damaging Het
Rxfp1 T A 3: 79,644,949 T682S probably damaging Het
Sertad2 GCCCC GCCCCC 11: 20,648,664 probably null Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Tdrd9 C T 12: 112,013,486 Q256* probably null Het
Tmprss11d A T 5: 86,309,279 S174T probably damaging Het
Tor1b T A 2: 30,956,519 I238N probably damaging Het
Tppp2 T C 14: 51,919,500 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Usp48 A G 4: 137,623,340 N46S possibly damaging Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp106 T C 2: 120,526,899 probably null Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Other mutations in Ssfa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ssfa2 APN 2 79657268 missense possibly damaging 0.94
IGL00792:Ssfa2 APN 2 79657463 missense probably benign 0.01
IGL00900:Ssfa2 APN 2 79660478 missense probably damaging 1.00
IGL00902:Ssfa2 APN 2 79660478 missense probably damaging 1.00
IGL01682:Ssfa2 APN 2 79635637 missense probably damaging 1.00
IGL01683:Ssfa2 APN 2 79670725 intron probably benign
IGL01832:Ssfa2 APN 2 79651418 missense possibly damaging 0.94
IGL02253:Ssfa2 APN 2 79660444 missense probably damaging 1.00
IGL02342:Ssfa2 APN 2 79660285 missense probably benign 0.01
IGL02420:Ssfa2 APN 2 79635642 missense probably damaging 0.99
IGL02445:Ssfa2 APN 2 79657498 missense probably damaging 0.98
IGL02649:Ssfa2 APN 2 79641959 splice site probably benign
IGL03242:Ssfa2 APN 2 79643471 nonsense probably null
IGL03266:Ssfa2 APN 2 79642190 critical splice donor site probably null
IGL03342:Ssfa2 APN 2 79660452 missense probably damaging 1.00
IGL03352:Ssfa2 APN 2 79645101 missense probably damaging 1.00
R0255:Ssfa2 UTSW 2 79660466 missense probably damaging 1.00
R0526:Ssfa2 UTSW 2 79657346 missense probably benign 0.01
R0543:Ssfa2 UTSW 2 79644506 missense possibly damaging 0.79
R1114:Ssfa2 UTSW 2 79657529 missense probably damaging 1.00
R1701:Ssfa2 UTSW 2 79636050 missense probably damaging 1.00
R1734:Ssfa2 UTSW 2 79657822 missense probably damaging 1.00
R1945:Ssfa2 UTSW 2 79662652 missense probably benign 0.03
R2188:Ssfa2 UTSW 2 79644923 missense probably benign 0.01
R2941:Ssfa2 UTSW 2 79635656 missense probably benign 0.19
R4107:Ssfa2 UTSW 2 79644831 missense probably damaging 0.97
R4355:Ssfa2 UTSW 2 79641998 missense probably benign 0.02
R4497:Ssfa2 UTSW 2 79657820 missense probably damaging 1.00
R4615:Ssfa2 UTSW 2 79662382 missense probably damaging 0.99
R4726:Ssfa2 UTSW 2 79662757 missense probably damaging 1.00
R5818:Ssfa2 UTSW 2 79644593 missense probably damaging 1.00
R5889:Ssfa2 UTSW 2 79657728 missense probably damaging 1.00
R6169:Ssfa2 UTSW 2 79645062 missense probably damaging 0.99
R6337:Ssfa2 UTSW 2 79655119 missense probably damaging 1.00
R6677:Ssfa2 UTSW 2 79655101 missense possibly damaging 0.92
R6709:Ssfa2 UTSW 2 79644932 missense probably benign 0.00
R6855:Ssfa2 UTSW 2 79657705 missense probably damaging 1.00
R6856:Ssfa2 UTSW 2 79657705 missense probably damaging 1.00
R7075:Ssfa2 UTSW 2 79635660 missense probably damaging 0.99
R7319:Ssfa2 UTSW 2 79636072 missense probably damaging 1.00
R7414:Ssfa2 UTSW 2 79644728 missense possibly damaging 0.95
R7590:Ssfa2 UTSW 2 79658110 missense possibly damaging 0.88
R7722:Ssfa2 UTSW 2 79662345 missense probably damaging 1.00
R7923:Ssfa2 UTSW 2 79662615 nonsense probably null
R8155:Ssfa2 UTSW 2 79644833 missense probably benign 0.01
R8175:Ssfa2 UTSW 2 79658152 missense probably damaging 1.00
R8237:Ssfa2 UTSW 2 79657270 missense probably benign 0.01
R8341:Ssfa2 UTSW 2 79657718 missense probably damaging 1.00
R8353:Ssfa2 UTSW 2 79644785 missense probably benign 0.01
R8364:Ssfa2 UTSW 2 79651443 missense probably damaging 0.99
R8365:Ssfa2 UTSW 2 79662345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGTCCCCAACATATCGG -3'
(R):5'- AGACACTCTGAGGTTCACACC -3'

Sequencing Primer
(F):5'- TCCCCAACATATCGGGTGCC -3'
(R):5'- CTCTACAAAGAGGAGATTCTCAGATG -3'
Posted On2016-01-06