Incidental Mutation 'R4091:Maml1'
ID368223
Institutional Source Beutler Lab
Gene Symbol Maml1
Ensembl Gene ENSMUSG00000050567
Gene Namemastermind like transcriptional coactivator 1
SynonymsD930008C07Rik, Mam-1
MMRRC Submission 041626-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4091 (G1)
Quality Score56.1
Status Validated
Chromosome11
Chromosomal Location50255634-50292311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50291829 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 78 (P78L)
Ref Sequence ENSEMBL: ENSMUSP00000059210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020637] [ENSMUST00000059458] [ENSMUST00000179865]
Predicted Effect probably benign
Transcript: ENSMUST00000020637
SMART Domains Protein: ENSMUSP00000020637
Gene: ENSMUSG00000020368

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 72 441 1.7e-170 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059458
AA Change: P78L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059210
Gene: ENSMUSG00000050567
AA Change: P78L

DomainStartEndE-ValueType
MamL-1 14 73 1.04e-32 SMART
low complexity region 77 102 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
low complexity region 373 383 N/A INTRINSIC
low complexity region 419 435 N/A INTRINSIC
low complexity region 588 600 N/A INTRINSIC
coiled coil region 627 671 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135868
SMART Domains Protein: ENSMUSP00000118188
Gene: ENSMUSG00000050567

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
low complexity region 334 350 N/A INTRINSIC
low complexity region 503 515 N/A INTRINSIC
coiled coil region 541 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146979
Predicted Effect probably benign
Transcript: ENSMUST00000179865
SMART Domains Protein: ENSMUSP00000137440
Gene: ENSMUSG00000020368

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 70 441 4.7e-166 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180443
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is the human homolog of mastermind, a Drosophila protein that plays a role in the Notch signaling pathway involved in cell-fate determination. There is in vitro evidence that the human homolog forms a complex with the intracellular portion of human Notch receptors and can increase expression of a Notch-induced gene. This evidence supports its proposed function as a transcriptional co-activator in the Notch signaling pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality, reduced size, and skeletal muscle degeneration and necrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,745,378 S674P possibly damaging Het
4932438A13Rik G A 3: 37,030,589 A3897T probably benign Het
A530099J19Rik T A 13: 19,729,465 noncoding transcript Het
Abca3 C T 17: 24,397,482 T966M probably damaging Het
Adam2 A T 14: 66,029,723 Y696N probably damaging Het
Aes G A 10: 81,565,584 G162D probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap25 G T 6: 87,463,035 S543R probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Carns1 C T 19: 4,171,683 R191Q probably damaging Het
Casp8ap2 C A 4: 32,643,611 P895T probably damaging Het
Col12a1 T A 9: 79,702,364 I287F probably damaging Het
Cystm1 A G 18: 36,366,547 N5S unknown Het
Dnah8 T C 17: 30,769,839 V3261A probably damaging Het
Dnajc11 A G 4: 151,978,093 probably benign Het
Dock4 T C 12: 40,844,267 S1847P probably damaging Het
Dync2h1 A G 9: 7,131,881 V1642A probably benign Het
Eftud2 T C 11: 102,839,416 probably null Het
Fam221b A G 4: 43,665,987 I208T probably benign Het
Gpr37l1 T C 1: 135,161,563 I255V probably benign Het
Grm7 G A 6: 110,914,340 S178N probably damaging Het
Hspa12b T A 2: 131,133,488 probably null Het
Kctd3 A T 1: 188,995,720 probably benign Het
Kynu G A 2: 43,679,872 V389M possibly damaging Het
Lcat A G 8: 105,939,906 L328P probably benign Het
Lrrn2 C T 1: 132,937,652 Q152* probably null Het
Mef2b G A 8: 70,165,102 V37M probably damaging Het
Mindy2 A T 9: 70,634,060 M281K probably damaging Het
Mon2 C T 10: 123,038,510 R311H probably damaging Het
Mtr A T 13: 12,231,057 V394E probably damaging Het
Myh14 T A 7: 44,632,991 T745S possibly damaging Het
Nme9 T A 9: 99,464,527 D131E possibly damaging Het
Nphp4 C A 4: 152,547,018 Q792K probably damaging Het
Nrxn2 T A 19: 6,473,414 C479S probably damaging Het
Nsmf T C 2: 25,060,859 I406T probably damaging Het
Olfr1431 A T 19: 12,209,779 D71V probably damaging Het
Olfr517 G A 7: 108,868,443 A237V probably damaging Het
Olfr945 T A 9: 39,258,034 I213F possibly damaging Het
Pbrm1 A G 14: 31,036,003 T197A probably benign Het
Pla2r1 T A 2: 60,432,593 N1034I probably damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp1 A T 3: 79,644,761 D744E probably benign Het
Samd9l T C 6: 3,376,887 N125D probably benign Het
Serpina3a G A 12: 104,116,366 V133I probably benign Het
Slc22a30 C T 19: 8,404,545 V121M probably damaging Het
Smarcc1 T A 9: 110,164,829 D247E possibly damaging Het
Smg9 T A 7: 24,420,867 L422Q probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Utrn T A 10: 12,710,171 D954V probably benign Het
Vmn1r227 T A 17: 20,735,516 noncoding transcript Het
Vmn2r11 A C 5: 109,054,750 probably null Het
Vmn2r84 A T 10: 130,391,369 M200K probably damaging Het
Vmn2r88 T A 14: 51,415,426 Y469N probably damaging Het
Wdcp A G 12: 4,855,279 N600S probably null Het
Wdfy4 T G 14: 33,125,880 R838S possibly damaging Het
Other mutations in Maml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Maml1 APN 11 50258714 missense probably damaging 0.97
IGL01326:Maml1 APN 11 50265888 missense probably benign 0.30
IGL01469:Maml1 APN 11 50266526 missense probably damaging 1.00
IGL02336:Maml1 APN 11 50258165 missense probably benign 0.00
IGL02690:Maml1 APN 11 50258630 missense probably damaging 1.00
R0674:Maml1 UTSW 11 50258058 missense probably benign 0.28
R1497:Maml1 UTSW 11 50265707 missense possibly damaging 0.51
R1641:Maml1 UTSW 11 50266947 missense probably benign 0.16
R1888:Maml1 UTSW 11 50266641 missense probably benign 0.00
R1888:Maml1 UTSW 11 50266641 missense probably benign 0.00
R1899:Maml1 UTSW 11 50266130 missense probably damaging 1.00
R2496:Maml1 UTSW 11 50258544 missense probably benign
R3913:Maml1 UTSW 11 50263432 missense probably benign 0.00
R4018:Maml1 UTSW 11 50265784 missense probably damaging 1.00
R4202:Maml1 UTSW 11 50257913 missense probably damaging 1.00
R4205:Maml1 UTSW 11 50257913 missense probably damaging 1.00
R4716:Maml1 UTSW 11 50257867 missense probably benign 0.01
R4816:Maml1 UTSW 11 50258335 missense possibly damaging 0.68
R5338:Maml1 UTSW 11 50266951 missense probably benign 0.11
R5460:Maml1 UTSW 11 50266353 missense probably benign 0.36
R6701:Maml1 UTSW 11 50266682 missense probably damaging 1.00
R7336:Maml1 UTSW 11 50266449 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCTGGAAGATGACAAGCGCC -3'
(R):5'- AATTTTAAGATGGCGGCGGC -3'

Sequencing Primer
(F):5'- ATGTTAGCCACCTCCCAGG -3'
(R):5'- TGTTCCCCGGCCTGGAATC -3'
Posted On2016-01-07