Incidental Mutation 'R4083:Kdm7a'
ID368228
Institutional Source Beutler Lab
Gene Symbol Kdm7a
Ensembl Gene ENSMUSG00000042599
Gene Namelysine (K)-specific demethylase 7A
SynonymsKdm7a, Jhdm1d, ENSMUSG00000073143, A630082K20Rik
MMRRC Submission 040978-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4083 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location39136623-39206789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39152814 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 476 (E476G)
Ref Sequence ENSEMBL: ENSMUSP00000002305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002305]
Predicted Effect probably damaging
Transcript: ENSMUST00000002305
AA Change: E476G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002305
Gene: ENSMUSG00000042599
AA Change: E476G

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
PHD 39 86 8.64e-9 SMART
low complexity region 186 197 N/A INTRINSIC
JmjC 230 386 1.09e-49 SMART
low complexity region 408 419 N/A INTRINSIC
low complexity region 653 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146981
Meta Mutation Damage Score 0.1410 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 97% (31/32)
MGI Phenotype PHENOTYPE: Homozygous mutants exhibit abnormal hair follicle, tail, sebaceous gland, rib, and vertebrae morphology and decreased circulating iron levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah2 A G 19: 31,986,784 S749P probably benign Het
Ccdc159 T C 9: 21,929,403 S89P possibly damaging Het
Cnbd1 A T 4: 18,886,042 S326T possibly damaging Het
Dpy19l1 G A 9: 24,485,048 T124M possibly damaging Het
Fmod A T 1: 134,040,305 I28F probably benign Het
Gm8674 A T 13: 49,901,011 noncoding transcript Het
Grm3 T G 5: 9,512,054 I599L probably benign Het
Hgf G T 5: 16,615,858 G668* probably null Het
Hsd17b11 A T 5: 103,990,568 V280D possibly damaging Het
Igkv8-26 G T 6: 70,193,563 S46I probably damaging Het
Lgals9 A T 11: 78,969,763 F162Y possibly damaging Het
Lig3 T A 11: 82,790,494 N437K probably benign Het
Mterf4 A C 1: 93,304,658 M157R possibly damaging Het
Nbas T C 12: 13,474,191 W1683R probably damaging Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Olfr116 T G 17: 37,624,425 D70A probably damaging Het
Olfr706 G T 7: 106,886,644 P58T probably damaging Het
Pcdh10 A C 3: 45,392,707 D979A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rab27a G T 9: 73,082,439 R64L probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc22a16 T A 10: 40,574,069 L167Q probably damaging Het
Srgap1 A G 10: 121,785,690 V989A probably damaging Het
Sstr2 T C 11: 113,625,245 V330A probably benign Het
Tdrd1 T C 19: 56,843,230 M351T probably benign Het
Trav7d-3 C A 14: 52,744,755 H84Q probably benign Het
Other mutations in Kdm7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kdm7a APN 6 39144510 missense probably benign
IGL00976:Kdm7a APN 6 39144398 missense possibly damaging 0.90
IGL01063:Kdm7a APN 6 39165130 missense probably damaging 0.98
IGL01325:Kdm7a APN 6 39158309 splice site probably benign
IGL01710:Kdm7a APN 6 39175386 missense probably benign 0.06
IGL01953:Kdm7a APN 6 39146902 missense probably benign 0.10
IGL02336:Kdm7a APN 6 39170264 missense probably damaging 1.00
IGL02721:Kdm7a APN 6 39173437 missense possibly damaging 0.93
IGL02963:Kdm7a APN 6 39143230 missense probably damaging 1.00
IGL03165:Kdm7a APN 6 39170914 splice site probably benign
R0033:Kdm7a UTSW 6 39165197 nonsense probably null
R0831:Kdm7a UTSW 6 39166765 splice site probably benign
R0920:Kdm7a UTSW 6 39151322 missense probably damaging 1.00
R0962:Kdm7a UTSW 6 39147194 missense probably benign 0.05
R1403:Kdm7a UTSW 6 39151253 splice site probably benign
R1632:Kdm7a UTSW 6 39152898 missense probably benign 0.15
R1759:Kdm7a UTSW 6 39147699 splice site probably null
R2143:Kdm7a UTSW 6 39168950 missense possibly damaging 0.61
R2197:Kdm7a UTSW 6 39146936 missense probably damaging 0.98
R2496:Kdm7a UTSW 6 39170763 splice site probably null
R3844:Kdm7a UTSW 6 39181579 missense probably damaging 1.00
R4184:Kdm7a UTSW 6 39148977 missense probably benign
R4193:Kdm7a UTSW 6 39169096 missense probably damaging 1.00
R4402:Kdm7a UTSW 6 39166668 missense probably null 1.00
R4544:Kdm7a UTSW 6 39175472 missense probably benign 0.08
R4546:Kdm7a UTSW 6 39175472 missense probably benign 0.08
R4560:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4561:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4562:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4563:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4737:Kdm7a UTSW 6 39152839 missense possibly damaging 0.57
R5061:Kdm7a UTSW 6 39151452 missense possibly damaging 0.88
R5247:Kdm7a UTSW 6 39144456 missense probably benign 0.00
R5430:Kdm7a UTSW 6 39149342 missense possibly damaging 0.85
R6248:Kdm7a UTSW 6 39147049 missense possibly damaging 0.63
R6254:Kdm7a UTSW 6 39170269 missense probably damaging 1.00
R6346:Kdm7a UTSW 6 39151211 intron probably null
R6420:Kdm7a UTSW 6 39165168 missense probably damaging 1.00
R6908:Kdm7a UTSW 6 39144439 missense possibly damaging 0.79
R6966:Kdm7a UTSW 6 39152839 missense probably damaging 1.00
R7048:Kdm7a UTSW 6 39169048 missense probably damaging 1.00
R7087:Kdm7a UTSW 6 39175381 missense probably benign 0.18
R7450:Kdm7a UTSW 6 39143251 missense probably damaging 1.00
R7737:Kdm7a UTSW 6 39144404 missense probably benign 0.03
RF012:Kdm7a UTSW 6 39206513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAACTGGAACTGCCTCTGTTG -3'
(R):5'- ATAAGATTCACTGTGAGGCAAATCC -3'

Sequencing Primer
(F):5'- GGAACTGCCTCTGTTGTTTTATAAC -3'
(R):5'- CCTCCTAGCTATTGGGATTAAAGGC -3'
Posted On2016-01-07