Mutagenetix > Incidental Mutations

Incidental Mutation 'R4240:Nphp4'

368231

Institutional Source

Beutler Lab

Gene Symbol

Nphp4

Ensembl Gene

ENSMUSG00000039577

Gene Name

nephronophthisis 4 (juvenile) homolog (human)

Synonyms

nmf192, 4930564O18Rik

MMRRC Submission

041057-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R4240 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

152476706-152563183 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 152555684 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1009 (D1009G)

Ref Sequence

ENSEMBL: ENSMUSP00000080128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]

Predicted Effect

probably benign
Transcript: ENSMUST00000056567
AA Change: D1009G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577
AA Change: D1009G

Domain	Start	End	E-Value	Type
low complexity region	317	333	N/A	INTRINSIC
low complexity region	367	380	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	507	530	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081393
AA Change: D1009G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577
AA Change: D1009G

Domain	Start	End	E-Value	Type
low complexity region	317	333	N/A	INTRINSIC
low complexity region	367	380	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	507	530	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142027

Meta Mutation Damage Score

0.1519

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.7%

Validation Efficiency

93% (50/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310050C09Rik	T	C	3: 92,868,591	I262V	possibly damaging	Het
4833420G17Rik	C	T	13: 119,466,942	P93S	probably benign	Het
4930488N24Rik	A	T	17: 14,105,787		noncoding transcript	Het
Areg	A	T	5: 91,143,516	N106I	probably damaging	Het
Ceacam3	G	A	7: 17,160,024	E487K	possibly damaging	Het
Cfap46	G	T	7: 139,666,287	Q387K	possibly damaging	Het
Cfap74	C	A	4: 155,463,072	H1238Q	probably benign	Het
Cnot6l	T	C	5: 96,077,362	T491A	probably benign	Het
Cog7	C	T	7: 121,925,484	V696M	possibly damaging	Het
Col22a1	C	T	15: 72,007,131	G59D	probably damaging	Het
Ddi1	A	G	9: 6,265,799	M190T	probably benign	Het
Eno1b	T	A	18: 48,047,840	S362T	probably benign	Het
Erbb2	A	G	11: 98,428,043	K549R	probably benign	Het
Fam170a	A	T	18: 50,281,667	M127L	possibly damaging	Het
Gm17677	T	A	9: 35,742,153	Y84*	probably null	Het
Gm1979	T	C	5: 26,001,121	T154A	probably benign	Het
Gm6871	G	T	7: 41,545,780	T511K	probably damaging	Het
Hsf4	A	G	8: 105,274,881	T378A	possibly damaging	Het
Irf2bpl	C	A	12: 86,882,917	Q327H	possibly damaging	Het
Klk6	A	G	7: 43,829,173	H168R	probably benign	Het
Kmt2d	G	A	15: 98,844,571		probably benign	Het
Lad1	T	A	1: 135,827,295	V103D	possibly damaging	Het
Mcm4	A	T	16: 15,627,706	Y692*	probably null	Het
Med15	C	T	16: 17,655,494	R497H	probably damaging	Het
Mfrp	T	C	9: 44,102,866	V177A	possibly damaging	Het
Mr1	T	C	1: 155,136,667	E167G	probably damaging	Het
Myo18b	A	G	5: 112,803,187		probably null	Het
Myom2	A	G	8: 15,132,895	D1444G	probably benign	Het
Nes	C	A	3: 87,979,359	P1598T	probably damaging	Het
Nlrp4d	A	T	7: 10,381,316	H479Q	noncoding transcript	Het
Olfr539	A	G	7: 140,667,583	N99D	probably benign	Het
Phactr1	T	A	13: 43,094,887	N437K	possibly damaging	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Prc1	G	A	7: 80,311,216		probably benign	Het
Rdh7	T	C	10: 127,885,802	I202V	probably benign	Het
Rsf1	C	CGGCGGCGGT	7: 97,579,935		probably benign	Het
Sgsm3	A	G	15: 81,011,782		probably benign	Het
Sipa1l2	T	C	8: 125,491,656	E314G	probably benign	Het
Slc8a3	T	C	12: 81,315,176	K290E	probably damaging	Het
Tbc1d17	T	C	7: 44,846,826	Y84C	probably damaging	Het
Usp46	T	G	5: 74,032,267		probably benign	Het
Vmn2r14	T	G	5: 109,216,411		probably null	Het
Vmn2r8	A	T	5: 108,797,503	V746D	probably damaging	Het
Xdh	A	G	17: 73,895,795	V1120A	possibly damaging	Het
Zbtb38	CTCTTCTTCTTCTTCTTCTTCTTC	CTCTTCTTCTTCTTCTTCTTC	9: 96,686,102		probably benign	Het
Zfp791	T	C	8: 85,109,666	H523R	probably null	Het
Zfp870	A	G	17: 32,885,736	I53T	probably benign	Het

Other mutations in Nphp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Nphp4	APN	4	152537309	splice site	probably benign
IGL00963:Nphp4	APN	4	152537861	missense	probably benign	0.01
IGL01571:Nphp4	APN	4	152556382	missense	probably benign	0.21
IGL01707:Nphp4	APN	4	152538983	missense	probably benign	0.00
IGL01837:Nphp4	APN	4	152488881	missense	probably damaging	0.96
IGL02341:Nphp4	APN	4	152555469	splice site	probably benign
IGL02558:Nphp4	APN	4	152555531	missense	probably damaging	1.00
IGL02563:Nphp4	APN	4	152556220	missense	probably benign	0.00
IGL02712:Nphp4	APN	4	152556275	missense	probably damaging	1.00
IGL03023:Nphp4	APN	4	152524235	splice site	probably null
R0280:Nphp4	UTSW	4	152551936	splice site	probably benign
R0317:Nphp4	UTSW	4	152551931	critical splice donor site	probably null
R0410:Nphp4	UTSW	4	152557046	missense	probably benign
R0433:Nphp4	UTSW	4	152518172	missense	probably benign	0.00
R0706:Nphp4	UTSW	4	152555617	missense	probably damaging	0.98
R0785:Nphp4	UTSW	4	152562109	missense	possibly damaging	0.58
R0890:Nphp4	UTSW	4	152498220	missense	possibly damaging	0.93
R0930:Nphp4	UTSW	4	152538055	missense	probably benign	0.01
R1202:Nphp4	UTSW	4	152488729	splice site	probably null
R1203:Nphp4	UTSW	4	152488832	missense	probably damaging	0.96
R1366:Nphp4	UTSW	4	152502926	missense	probably damaging	0.96
R1452:Nphp4	UTSW	4	152547018	missense	probably damaging	0.99
R1598:Nphp4	UTSW	4	152562090	missense	probably benign	0.00
R1699:Nphp4	UTSW	4	152496664	missense	probably damaging	0.99
R2007:Nphp4	UTSW	4	152554654	missense	probably damaging	0.97
R2082:Nphp4	UTSW	4	152559364	missense	probably benign	0.38
R2264:Nphp4	UTSW	4	152503008	splice site	probably benign
R2280:Nphp4	UTSW	4	152557043	missense	possibly damaging	0.95
R2281:Nphp4	UTSW	4	152557043	missense	possibly damaging	0.95
R2926:Nphp4	UTSW	4	152518139	missense	probably damaging	0.99
R3764:Nphp4	UTSW	4	152538017	splice site	probably benign
R4084:Nphp4	UTSW	4	152488791	missense	probably damaging	1.00
R4091:Nphp4	UTSW	4	152547018	missense	probably damaging	0.97
R4701:Nphp4	UTSW	4	152496659	missense	probably damaging	1.00
R4778:Nphp4	UTSW	4	152556291	missense	probably benign	0.44
R4783:Nphp4	UTSW	4	152554546	missense	probably benign	0.00
R4784:Nphp4	UTSW	4	152554546	missense	probably benign	0.00
R4974:Nphp4	UTSW	4	152537793	missense	probably damaging	1.00
R5053:Nphp4	UTSW	4	152544462	splice site	probably null
R5117:Nphp4	UTSW	4	152524232	splice site	probably null
R5128:Nphp4	UTSW	4	152502991	missense	probably benign	0.01
R5665:Nphp4	UTSW	4	152506485	missense	probably benign	0.25
R5890:Nphp4	UTSW	4	152547079	missense	probably benign	0.44
R6171:Nphp4	UTSW	4	152544449	missense	probably damaging	0.99
R6601:Nphp4	UTSW	4	152503007	splice site	probably null
R6772:Nphp4	UTSW	4	152544406	missense	probably benign	0.07
R6806:Nphp4	UTSW	4	152538101	missense	probably benign	0.02
R7006:Nphp4	UTSW	4	152488802	missense	probably benign	0.12
R7124:Nphp4	UTSW	4	152555684	missense	probably benign	0.07
R7381:Nphp4	UTSW	4	152499003	missense	possibly damaging	0.94
R7411:Nphp4	UTSW	4	152554717	missense	probably benign	0.25
R7638:Nphp4	UTSW	4	152554534	missense	probably benign	0.08
R7814:Nphp4	UTSW	4	152524272	missense	possibly damaging	0.93
R7814:Nphp4	UTSW	4	152544403	missense	probably damaging	1.00
R7841:Nphp4	UTSW	4	152496683	missense	probably benign	0.01
R8346:Nphp4	UTSW	4	152561321	missense	probably damaging	1.00
R8479:Nphp4	UTSW	4	152524290	missense	probably benign	0.01
T0970:Nphp4	UTSW	4	152556379	missense	probably damaging	1.00
X0058:Nphp4	UTSW	4	152559707	missense	possibly damaging	0.95
Z1177:Nphp4	UTSW	4	152518196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTGATGCCTACCGGGAAC -3'
(R):5'- TGTTAGAACTGTCCAACGCCC -3'

Sequencing Primer
(F):5'- ACGTACCAAGGCCGAGAGC -3'
(R):5'- ACAGTTGGCTGGGTCACATACAC -3'

Posted On

2016-01-07