Incidental Mutation 'R4240:Nphp4'
ID368231
Institutional Source Beutler Lab
Gene Symbol Nphp4
Ensembl Gene ENSMUSG00000039577
Gene Namenephronophthisis 4 (juvenile) homolog (human)
Synonymsnmf192, 4930564O18Rik
MMRRC Submission 041057-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R4240 (G1)
Quality Score79
Status Validated
Chromosome4
Chromosomal Location152476706-152563183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152555684 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1009 (D1009G)
Ref Sequence ENSEMBL: ENSMUSP00000080128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]
Predicted Effect probably benign
Transcript: ENSMUST00000056567
AA Change: D1009G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577
AA Change: D1009G

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081393
AA Change: D1009G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577
AA Change: D1009G

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142027
Meta Mutation Damage Score 0.1519 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 93% (50/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,591 I262V possibly damaging Het
4833420G17Rik C T 13: 119,466,942 P93S probably benign Het
4930488N24Rik A T 17: 14,105,787 noncoding transcript Het
Areg A T 5: 91,143,516 N106I probably damaging Het
Ceacam3 G A 7: 17,160,024 E487K possibly damaging Het
Cfap46 G T 7: 139,666,287 Q387K possibly damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Cnot6l T C 5: 96,077,362 T491A probably benign Het
Cog7 C T 7: 121,925,484 V696M possibly damaging Het
Col22a1 C T 15: 72,007,131 G59D probably damaging Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Eno1b T A 18: 48,047,840 S362T probably benign Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fam170a A T 18: 50,281,667 M127L possibly damaging Het
Gm17677 T A 9: 35,742,153 Y84* probably null Het
Gm1979 T C 5: 26,001,121 T154A probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Hsf4 A G 8: 105,274,881 T378A possibly damaging Het
Irf2bpl C A 12: 86,882,917 Q327H possibly damaging Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Kmt2d G A 15: 98,844,571 probably benign Het
Lad1 T A 1: 135,827,295 V103D possibly damaging Het
Mcm4 A T 16: 15,627,706 Y692* probably null Het
Med15 C T 16: 17,655,494 R497H probably damaging Het
Mfrp T C 9: 44,102,866 V177A possibly damaging Het
Mr1 T C 1: 155,136,667 E167G probably damaging Het
Myo18b A G 5: 112,803,187 probably null Het
Myom2 A G 8: 15,132,895 D1444G probably benign Het
Nes C A 3: 87,979,359 P1598T probably damaging Het
Nlrp4d A T 7: 10,381,316 H479Q noncoding transcript Het
Olfr539 A G 7: 140,667,583 N99D probably benign Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Rdh7 T C 10: 127,885,802 I202V probably benign Het
Rsf1 C CGGCGGCGGT 7: 97,579,935 probably benign Het
Sgsm3 A G 15: 81,011,782 probably benign Het
Sipa1l2 T C 8: 125,491,656 E314G probably benign Het
Slc8a3 T C 12: 81,315,176 K290E probably damaging Het
Tbc1d17 T C 7: 44,846,826 Y84C probably damaging Het
Usp46 T G 5: 74,032,267 probably benign Het
Vmn2r14 T G 5: 109,216,411 probably null Het
Vmn2r8 A T 5: 108,797,503 V746D probably damaging Het
Xdh A G 17: 73,895,795 V1120A possibly damaging Het
Zbtb38 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTCTTC 9: 96,686,102 probably benign Het
Zfp791 T C 8: 85,109,666 H523R probably null Het
Zfp870 A G 17: 32,885,736 I53T probably benign Het
Other mutations in Nphp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Nphp4 APN 4 152537309 splice site probably benign
IGL00963:Nphp4 APN 4 152537861 missense probably benign 0.01
IGL01571:Nphp4 APN 4 152556382 missense probably benign 0.21
IGL01707:Nphp4 APN 4 152538983 missense probably benign 0.00
IGL01837:Nphp4 APN 4 152488881 missense probably damaging 0.96
IGL02341:Nphp4 APN 4 152555469 splice site probably benign
IGL02558:Nphp4 APN 4 152555531 missense probably damaging 1.00
IGL02563:Nphp4 APN 4 152556220 missense probably benign 0.00
IGL02712:Nphp4 APN 4 152556275 missense probably damaging 1.00
IGL03023:Nphp4 APN 4 152524235 splice site probably null
R0280:Nphp4 UTSW 4 152551936 splice site probably benign
R0317:Nphp4 UTSW 4 152551931 critical splice donor site probably null
R0410:Nphp4 UTSW 4 152557046 missense probably benign
R0433:Nphp4 UTSW 4 152518172 missense probably benign 0.00
R0706:Nphp4 UTSW 4 152555617 missense probably damaging 0.98
R0785:Nphp4 UTSW 4 152562109 missense possibly damaging 0.58
R0890:Nphp4 UTSW 4 152498220 missense possibly damaging 0.93
R0930:Nphp4 UTSW 4 152538055 missense probably benign 0.01
R1202:Nphp4 UTSW 4 152488729 splice site probably null
R1203:Nphp4 UTSW 4 152488832 missense probably damaging 0.96
R1366:Nphp4 UTSW 4 152502926 missense probably damaging 0.96
R1452:Nphp4 UTSW 4 152547018 missense probably damaging 0.99
R1598:Nphp4 UTSW 4 152562090 missense probably benign 0.00
R1699:Nphp4 UTSW 4 152496664 missense probably damaging 0.99
R2007:Nphp4 UTSW 4 152554654 missense probably damaging 0.97
R2082:Nphp4 UTSW 4 152559364 missense probably benign 0.38
R2264:Nphp4 UTSW 4 152503008 splice site probably benign
R2280:Nphp4 UTSW 4 152557043 missense possibly damaging 0.95
R2281:Nphp4 UTSW 4 152557043 missense possibly damaging 0.95
R2926:Nphp4 UTSW 4 152518139 missense probably damaging 0.99
R3764:Nphp4 UTSW 4 152538017 splice site probably benign
R4084:Nphp4 UTSW 4 152488791 missense probably damaging 1.00
R4091:Nphp4 UTSW 4 152547018 missense probably damaging 0.97
R4701:Nphp4 UTSW 4 152496659 missense probably damaging 1.00
R4778:Nphp4 UTSW 4 152556291 missense probably benign 0.44
R4783:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4784:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4974:Nphp4 UTSW 4 152537793 missense probably damaging 1.00
R5053:Nphp4 UTSW 4 152544462 splice site probably null
R5117:Nphp4 UTSW 4 152524232 splice site probably null
R5128:Nphp4 UTSW 4 152502991 missense probably benign 0.01
R5665:Nphp4 UTSW 4 152506485 missense probably benign 0.25
R5890:Nphp4 UTSW 4 152547079 missense probably benign 0.44
R6171:Nphp4 UTSW 4 152544449 missense probably damaging 0.99
R6601:Nphp4 UTSW 4 152503007 splice site probably null
R6772:Nphp4 UTSW 4 152544406 missense probably benign 0.07
R6806:Nphp4 UTSW 4 152538101 missense probably benign 0.02
R7006:Nphp4 UTSW 4 152488802 missense probably benign 0.12
R7124:Nphp4 UTSW 4 152555684 missense probably benign 0.07
R7381:Nphp4 UTSW 4 152499003 missense possibly damaging 0.94
R7411:Nphp4 UTSW 4 152554717 missense probably benign 0.25
R7638:Nphp4 UTSW 4 152554534 missense probably benign 0.08
R7814:Nphp4 UTSW 4 152524272 missense possibly damaging 0.93
R7814:Nphp4 UTSW 4 152544403 missense probably damaging 1.00
R7841:Nphp4 UTSW 4 152496683 missense probably benign 0.01
T0970:Nphp4 UTSW 4 152556379 missense probably damaging 1.00
X0058:Nphp4 UTSW 4 152559707 missense possibly damaging 0.95
Z1177:Nphp4 UTSW 4 152518196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGATGCCTACCGGGAAC -3'
(R):5'- TGTTAGAACTGTCCAACGCCC -3'

Sequencing Primer
(F):5'- ACGTACCAAGGCCGAGAGC -3'
(R):5'- ACAGTTGGCTGGGTCACATACAC -3'
Posted On2016-01-07