Mutagenetix > Incidental Mutation

Incidental Mutation 'R4074:Nup205'

368235

Institutional Source

Beutler Lab

Gene Symbol

Nup205

Ensembl Gene

ENSMUSG00000038759

Gene Name

nucleoporin 205

Synonyms

3830404O05Rik

MMRRC Submission

040855-MU

Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R4074 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

35177421-35247596 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 35192040 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]

AlphaFold

A0A0J9YUD5

Predicted Effect

probably null
Transcript: ENSMUST00000043815

SMART Domains

Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:Nup192	14	1684	N/A	PFAM
low complexity region	1995	2005	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170234

SMART Domains

Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

Domain	Start	End	E-Value	Type
Pfam:DUF3414	13	322	9.7e-98	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000201374

SMART Domains

Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759

Domain	Start	End	E-Value	Type
low complexity region	36	50	N/A	INTRINSIC
Pfam:Nup192	67	1737	N/A	PFAM
low complexity region	2048	2058	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202898

Meta Mutation Damage Score

0.9497

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

95% (63/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]

Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	T	C	2: 19,480,590	E422G	probably damaging	Het
5830473C10Rik	T	A	5: 90,592,868		probably null	Het
8430408G22Rik	A	G	6: 116,652,068	N124S	possibly damaging	Het
Ace3	A	G	11: 105,997,214	Y287C	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atg12	A	G	18: 46,737,424	F92L	probably benign	Het
Axl	A	G	7: 25,763,911		probably benign	Het
Chgb	C	A	2: 132,793,927	D596E	possibly damaging	Het
Cmtr2	T	A	8: 110,221,217	F53Y	possibly damaging	Het
Cnot10	A	G	9: 114,622,947	F254L	possibly damaging	Het
Crb2	G	T	2: 37,786,843	C251F	probably damaging	Het
Crybg3	A	T	16: 59,555,757		probably benign	Het
Cytl1	A	G	5: 37,735,596	I17V	unknown	Het
D930020B18Rik	A	G	10: 121,656,218		probably benign	Het
Dnah11	A	G	12: 118,045,678	M2083T	probably benign	Het
Dst	A	G	1: 34,192,269	E2656G	probably benign	Het
Dst	T	C	1: 34,228,461	F4995L	probably damaging	Het
Egf	C	T	3: 129,735,969	R264Q	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ero1l	A	T	14: 45,292,436		probably null	Het
Etl4	T	C	2: 20,809,219		probably benign	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Glt6d1	T	C	2: 25,794,127	D289G	probably damaging	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm5134	T	A	10: 76,008,531	W574R	probably damaging	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Gm5414	T	C	15: 101,625,553	N332D	probably benign	Het
Gnb3	T	A	6: 124,836,979	E215D	probably benign	Het
Ighv1-30	C	T	12: 114,817,401		noncoding transcript	Het
Ighv1-4	A	G	12: 114,487,527	S15P	possibly damaging	Het
Igkv1-133	T	G	6: 67,725,521	Y74*	probably null	Het
Il17f	G	A	1: 20,777,763		probably benign	Het
Itpr2	C	T	6: 146,373,244		probably null	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lilra6	A	T	7: 3,914,890	F85Y	probably benign	Het
Lrig3	C	T	10: 126,013,408	T999I	probably benign	Het
Myh7b	T	C	2: 155,618,758	I277T	probably damaging	Het
Myo3b	T	C	2: 70,289,464	F984S	probably damaging	Het
Naip5	G	A	13: 100,246,064	R46W	probably damaging	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde11a	C	T	2: 76,337,898	R237H	probably damaging	Het
Pdk4	T	C	6: 5,491,865	N69S	probably benign	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Psg23	A	T	7: 18,607,118	S404T	possibly damaging	Het
Rev1	T	G	1: 38,054,238	K1075T	possibly damaging	Het
Rrbp1	T	G	2: 143,963,110	Q1045P	probably benign	Het
Scg2	A	C	1: 79,436,857	F50V	probably damaging	Het
Sel1l3	A	G	5: 53,154,287	Y619H	probably damaging	Het
Slco1a5	A	T	6: 142,268,224	I57K	possibly damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Swt1	A	G	1: 151,394,769	V565A	probably benign	Het
Tesk1	A	G	4: 43,443,606	I58V	possibly damaging	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tnxb	A	G	17: 34,671,871	N396S	probably benign	Het
Tuba8	T	A	6: 121,222,797	S147T	probably damaging	Het
Usp8	A	G	2: 126,752,370	D822G	probably damaging	Het
Vmn2r13	T	A	5: 109,156,700	I622F	probably damaging	Het
Vmn2r24	A	T	6: 123,787,415	H417L	possibly damaging	Het
Zfp608	A	T	18: 54,898,108	V920E	probably damaging	Het
Zmym2	T	C	14: 56,903,004	L100P	probably damaging	Het

Other mutations in Nup205

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Nup205	APN	6	35214802	missense	probably damaging	1.00
IGL01086:Nup205	APN	6	35208936	splice site	probably benign
IGL01138:Nup205	APN	6	35208084	nonsense	probably null
IGL01333:Nup205	APN	6	35241063	missense	probably benign
IGL01399:Nup205	APN	6	35219689	missense	possibly damaging	0.80
IGL01466:Nup205	APN	6	35199959	missense	probably benign	0.08
IGL01913:Nup205	APN	6	35227430	missense	probably benign	0.10
IGL02159:Nup205	APN	6	35189178	missense	probably damaging	1.00
IGL02442:Nup205	APN	6	35190068	missense	probably benign	0.01
IGL02447:Nup205	APN	6	35227576	splice site	probably null
IGL02558:Nup205	APN	6	35189924	missense	probably damaging	1.00
IGL03306:Nup205	APN	6	35208169	missense	probably damaging	0.98
IGL03328:Nup205	APN	6	35232414	missense	probably damaging	0.99
Figaro	UTSW	6	35196714	splice site	probably null
Marcellina	UTSW	6	35183969	missense	probably damaging	1.00
Spirit	UTSW	6	35232408	missense	probably damaging	0.98
Susanna	UTSW	6	35208109	missense	possibly damaging	0.94
voyager	UTSW	6	35189885	missense	possibly damaging	0.80
BB007:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
BB017:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
P0012:Nup205	UTSW	6	35196543	missense	possibly damaging	0.90
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0362:Nup205	UTSW	6	35196714	splice site	probably null
R0374:Nup205	UTSW	6	35208837	missense	probably damaging	1.00
R0415:Nup205	UTSW	6	35214634	splice site	probably benign
R0427:Nup205	UTSW	6	35194463	missense	probably benign	0.01
R0543:Nup205	UTSW	6	35198969	missense	probably benign
R0611:Nup205	UTSW	6	35225968	missense	probably null	1.00
R0761:Nup205	UTSW	6	35196428	splice site	probably benign
R0828:Nup205	UTSW	6	35194566	missense	probably benign
R0906:Nup205	UTSW	6	35236892	missense	probably damaging	1.00
R1023:Nup205	UTSW	6	35234706	missense	probably damaging	0.98
R1033:Nup205	UTSW	6	35227442	missense	probably benign
R1375:Nup205	UTSW	6	35200071	splice site	probably benign
R1447:Nup205	UTSW	6	35215185	missense	probably benign	0.00
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1625:Nup205	UTSW	6	35191943	missense	probably benign	0.31
R1652:Nup205	UTSW	6	35238966	missense	probably benign
R1659:Nup205	UTSW	6	35234788	missense	probably benign	0.02
R1693:Nup205	UTSW	6	35210971	missense	probably benign	0.05
R1769:Nup205	UTSW	6	35205431	missense	probably damaging	1.00
R1839:Nup205	UTSW	6	35219714	missense	probably benign	0.00
R1959:Nup205	UTSW	6	35233366	missense	probably benign	0.16
R2051:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R2267:Nup205	UTSW	6	35241349	missense	possibly damaging	0.67
R2401:Nup205	UTSW	6	35208134	nonsense	probably null
R3697:Nup205	UTSW	6	35188711	missense	probably benign	0.15
R3938:Nup205	UTSW	6	35219742	missense	probably damaging	1.00
R4117:Nup205	UTSW	6	35241012	nonsense	probably null
R4364:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4366:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4594:Nup205	UTSW	6	35196489	missense	probably benign	0.00
R4706:Nup205	UTSW	6	35202008	missense	probably damaging	1.00
R4787:Nup205	UTSW	6	35202061	missense	probably damaging	1.00
R4849:Nup205	UTSW	6	35230570	missense	possibly damaging	0.90
R4850:Nup205	UTSW	6	35230530	missense	probably benign	0.16
R4943:Nup205	UTSW	6	35224639	missense	probably damaging	1.00
R4966:Nup205	UTSW	6	35243849	missense	probably benign	0.00
R5138:Nup205	UTSW	6	35225866	missense	probably damaging	1.00
R5251:Nup205	UTSW	6	35196482	splice site	probably null
R5444:Nup205	UTSW	6	35189189	missense	probably damaging	0.98
R5760:Nup205	UTSW	6	35247343	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35227680	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35230548	missense	probably damaging	0.96
R5941:Nup205	UTSW	6	35232408	missense	probably damaging	0.98
R5969:Nup205	UTSW	6	35177578	unclassified	probably benign
R6003:Nup205	UTSW	6	35212816	missense	probably benign
R6178:Nup205	UTSW	6	35243843	missense	possibly damaging	0.85
R6315:Nup205	UTSW	6	35236869	missense	probably damaging	1.00
R6392:Nup205	UTSW	6	35189885	missense	possibly damaging	0.80
R6710:Nup205	UTSW	6	35247373	missense	probably benign	0.00
R6954:Nup205	UTSW	6	35208109	missense	possibly damaging	0.94
R7022:Nup205	UTSW	6	35243936	missense	probably benign	0.45
R7041:Nup205	UTSW	6	35224535	missense	possibly damaging	0.49
R7052:Nup205	UTSW	6	35215142	missense	possibly damaging	0.81
R7310:Nup205	UTSW	6	35225969	missense	possibly damaging	0.78
R7363:Nup205	UTSW	6	35232573	missense	probably benign	0.28
R7399:Nup205	UTSW	6	35214676	missense	probably damaging	0.99
R7428:Nup205	UTSW	6	35227559	missense	probably damaging	1.00
R7553:Nup205	UTSW	6	35201999	missense	probably damaging	1.00
R7665:Nup205	UTSW	6	35177620	missense	possibly damaging	0.46
R7841:Nup205	UTSW	6	35247437	missense	unknown
R7930:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
R7973:Nup205	UTSW	6	35245339	missense	probably benign
R7976:Nup205	UTSW	6	35198953	missense	probably damaging	1.00
R8073:Nup205	UTSW	6	35202169	critical splice donor site	probably null
R8080:Nup205	UTSW	6	35227376	missense	probably damaging	1.00
R8118:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R8213:Nup205	UTSW	6	35225203	missense	probably benign	0.26
R8237:Nup205	UTSW	6	35227503	missense	possibly damaging	0.89
R8408:Nup205	UTSW	6	35225247	missense	probably damaging	1.00
R8807:Nup205	UTSW	6	35183969	missense	probably damaging	1.00
R8812:Nup205	UTSW	6	35214334	missense	probably damaging	1.00
R9061:Nup205	UTSW	6	35219873	intron	probably benign
R9261:Nup205	UTSW	6	35199857	missense	probably benign	0.00
R9403:Nup205	UTSW	6	35199974	missense	probably benign	0.45
R9648:Nup205	UTSW	6	35225811	missense	probably benign	0.00
R9744:Nup205	UTSW	6	35232575	missense	probably damaging	0.99
R9800:Nup205	UTSW	6	35186533	missense	possibly damaging	0.85
Z1177:Nup205	UTSW	6	35177605	missense	unknown
Z1177:Nup205	UTSW	6	35208793	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCATGTGTGACGGATGTGAG -3'
(R):5'- CTACTTTACAAAGTTATGAGGGGTGTG -3'

Sequencing Primer
(F):5'- ACGGATGTGAGAATTTATTTCTGCTC -3'
(R):5'- CCTACATCCTGAGTGCTGGAATG -3'

Posted On

2016-01-07