Mutagenetix > Incidental Mutations

Incidental Mutation 'R4018:Tsc2'

368237

Institutional Source

Beutler Lab

Gene Symbol

Tsc2

Ensembl Gene

ENSMUSG00000002496

Gene Name

tuberous sclerosis 2

Synonyms

tuberin, Nafld

MMRRC Submission

040848-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4018 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

24595816-24632630 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24625281 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 279 (I279V)

Ref Sequence

ENSEMBL: ENSMUSP00000153792 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097373] [ENSMUST00000226284] [ENSMUST00000226398] [ENSMUST00000227607] [ENSMUST00000227745] [ENSMUST00000228412]

Predicted Effect

probably damaging
Transcript: ENSMUST00000097373
AA Change: I279V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000094986
Gene: ENSMUSG00000002496
AA Change: I279V

Domain	Start	End	E-Value	Type
Pfam:DUF3384	54	470	4e-103	PFAM
Pfam:Tuberin	555	903	5.9e-149	PFAM
low complexity region	1023	1054	N/A	INTRINSIC
low complexity region	1271	1278	N/A	INTRINSIC
low complexity region	1310	1328	N/A	INTRINSIC
low complexity region	1330	1344	N/A	INTRINSIC
low complexity region	1378	1398	N/A	INTRINSIC
Pfam:Rap_GAP	1497	1685	1.3e-43	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000226284
AA Change: I279V

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000226398
AA Change: I279V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000227607
AA Change: I220V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Predicted Effect

probably benign
Transcript: ENSMUST00000227745
AA Change: I279V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227754

Predicted Effect

probably benign
Transcript: ENSMUST00000228412
AA Change: I279V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 92.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene lead to tuberous sclerosis complex. Its gene product is believed to be a tumor suppressor and is able to stimulate specific GTPases. The protein associates with hamartin in a cytosolic complex, possibly acting as a chaperone for hamartin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit liver hypoplasia, open neural tube, thickened myocardium and die by embryonic day 9.5-12.5. Heterozygotes develop renal cystadenomas, liver hemangiomas (sometimes resulting in fatal bleeding) and lung adenomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aga	A	G	8: 53,523,191	K319R	probably benign	Het
Brip1	G	T	11: 86,138,851	T619K	possibly damaging	Het
Cd300ld2	G	T	11: 115,012,504		probably benign	Het
Cd300lg	A	G	11: 102,041,594	R2G	probably damaging	Het
Celsr2	C	T	3: 108,394,965	V2616I	possibly damaging	Het
Edem3	C	T	1: 151,804,826		probably benign	Het
Endou	T	A	15: 97,718,937	K235M	probably damaging	Het
Gm5431	T	A	11: 48,889,168	N309I	probably damaging	Het
Il4	T	A	11: 53,613,979		probably benign	Het
Iws1	C	A	18: 32,070,152	S27*	probably null	Het
Kdm5d	T	C	Y: 910,441		probably benign	Het
Ldb3	T	C	14: 34,552,171		probably benign	Het
Llgl2	A	G	11: 115,847,612	T284A	probably benign	Het
Maml1	A	T	11: 50,265,784	N521K	probably damaging	Het
Mlxipl	T	C	5: 135,132,672	Y482H	probably damaging	Het
Notch2	G	T	3: 98,104,565	C633F	probably damaging	Het
Oc90	T	C	15: 65,887,608	D232G	probably benign	Het
Olfr1453	T	C	19: 13,027,825	E168G	probably benign	Het
Polr2a	T	C	11: 69,735,059	Y1717C	unknown	Het
Prkca	T	A	11: 107,939,602	I221F	probably damaging	Het
Rab3c	T	A	13: 110,084,194	K144N	probably damaging	Het
Ryr2	T	A	13: 11,918,414	N57I	probably damaging	Het
Scyl3	A	G	1: 163,936,499	T145A	possibly damaging	Het
Sept4	G	A	11: 87,585,121	R162Q	probably damaging	Het
Slc25a39	A	T	11: 102,405,024	L127H	probably damaging	Het
Slc9a9	T	C	9: 94,685,163	V95A	probably benign	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r6	T	C	3: 64,556,472	I314V	probably benign	Het
Wdr66	A	G	5: 123,322,454	I1160V	probably benign	Het

Other mutations in Tsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Tsc2	APN	17	24608107	missense	probably damaging	1.00
IGL00985:Tsc2	APN	17	24597131	missense	probably damaging	1.00
IGL01386:Tsc2	APN	17	24613285	missense	probably damaging	1.00
IGL01468:Tsc2	APN	17	24621097	missense	possibly damaging	0.90
IGL01530:Tsc2	APN	17	24622662	missense	possibly damaging	0.76
IGL02390:Tsc2	APN	17	24600453	missense	probably damaging	1.00
IGL02398:Tsc2	APN	17	24621729	missense	probably damaging	1.00
IGL02741:Tsc2	APN	17	24629969	missense	probably damaging	1.00
IGL03191:Tsc2	APN	17	24628054	missense	probably damaging	1.00
IGL03372:Tsc2	APN	17	24619470	missense	probably damaging	1.00
IGL03412:Tsc2	APN	17	24597068	missense	probably damaging	0.98
Twitch	UTSW	17	24596742	splice site	probably null
PIT4515001:Tsc2	UTSW	17	24621147	missense	probably benign	0.15
R0025:Tsc2	UTSW	17	24631004	splice site	probably benign
R0025:Tsc2	UTSW	17	24631004	splice site	probably benign
R0138:Tsc2	UTSW	17	24599626	missense	possibly damaging	0.65
R0540:Tsc2	UTSW	17	24621712	missense	probably damaging	1.00
R0570:Tsc2	UTSW	17	24626727	missense	probably damaging	1.00
R0607:Tsc2	UTSW	17	24621712	missense	probably damaging	1.00
R0826:Tsc2	UTSW	17	24596958	missense	probably benign	0.04
R1430:Tsc2	UTSW	17	24599023	critical splice donor site	probably null
R1440:Tsc2	UTSW	17	24614392	missense	probably damaging	1.00
R1466:Tsc2	UTSW	17	24608973	missense	probably damaging	1.00
R1466:Tsc2	UTSW	17	24608973	missense	probably damaging	1.00
R1541:Tsc2	UTSW	17	24631976	missense	probably damaging	1.00
R1717:Tsc2	UTSW	17	24597068	missense	probably damaging	0.98
R1799:Tsc2	UTSW	17	24604408	missense	probably benign
R2030:Tsc2	UTSW	17	24623470	splice site	probably benign
R2147:Tsc2	UTSW	17	24621142	missense	possibly damaging	0.62
R2888:Tsc2	UTSW	17	24631995	critical splice donor site	probably null
R3609:Tsc2	UTSW	17	24622550	missense	possibly damaging	0.74
R3610:Tsc2	UTSW	17	24622550	missense	possibly damaging	0.74
R3811:Tsc2	UTSW	17	24629037	missense	probably benign	0.09
R3895:Tsc2	UTSW	17	24599812	missense	probably damaging	1.00
R3962:Tsc2	UTSW	17	24621166	splice site	probably benign
R3971:Tsc2	UTSW	17	24623588	missense	probably damaging	1.00
R4184:Tsc2	UTSW	17	24632016	missense	probably benign	0.43
R4435:Tsc2	UTSW	17	24599713	missense	probably benign	0.01
R4437:Tsc2	UTSW	17	24599713	missense	probably benign	0.01
R4474:Tsc2	UTSW	17	24597264	missense	probably damaging	0.98
R4703:Tsc2	UTSW	17	24604909	missense	probably benign	0.13
R4731:Tsc2	UTSW	17	24603275	missense	possibly damaging	0.72
R4732:Tsc2	UTSW	17	24603275	missense	possibly damaging	0.72
R4733:Tsc2	UTSW	17	24603275	missense	possibly damaging	0.72
R4817:Tsc2	UTSW	17	24596742	splice site	probably null
R4890:Tsc2	UTSW	17	24600035	missense	probably damaging	1.00
R4922:Tsc2	UTSW	17	24600369	missense	probably benign	0.22
R5119:Tsc2	UTSW	17	24603280	missense	probably benign	0.00
R5393:Tsc2	UTSW	17	24600396	missense	possibly damaging	0.89
R5785:Tsc2	UTSW	17	24599887	splice site	probably null
R5838:Tsc2	UTSW	17	24613216	missense	probably benign	0.01
R5857:Tsc2	UTSW	17	24600007	missense	probably damaging	0.99
R5911:Tsc2	UTSW	17	24600387	missense	possibly damaging	0.63
R5988:Tsc2	UTSW	17	24620766	missense	probably damaging	1.00
R6275:Tsc2	UTSW	17	24600420	missense	probably benign	0.00
R6290:Tsc2	UTSW	17	24596910	missense	probably benign	0.04
R6371:Tsc2	UTSW	17	24626714	missense	probably benign	0.00
R6467:Tsc2	UTSW	17	24609127	missense	probably benign	0.04
R6577:Tsc2	UTSW	17	24610499	missense	probably damaging	1.00
R6728:Tsc2	UTSW	17	24621124	missense	probably damaging	1.00
R6918:Tsc2	UTSW	17	24613229	missense	probably damaging	1.00
R6995:Tsc2	UTSW	17	24628054	missense	probably damaging	1.00
R7026:Tsc2	UTSW	17	24626739	missense	probably damaging	0.99
R7136:Tsc2	UTSW	17	24613280	missense	probably benign	0.00
R7236:Tsc2	UTSW	17	24623594	missense	possibly damaging	0.82
R7243:Tsc2	UTSW	17	24599630	missense	probably benign	0.02
R7249:Tsc2	UTSW	17	24607755	missense	probably damaging	1.00
R7450:Tsc2	UTSW	17	24600031	missense	probably damaging	1.00
R7522:Tsc2	UTSW	17	24630965	missense	probably damaging	1.00
R7529:Tsc2	UTSW	17	24597948	missense	probably damaging	0.98
R7637:Tsc2	UTSW	17	24607492	missense	probably benign	0.13
R7781:Tsc2	UTSW	17	24608115	missense	possibly damaging	0.52
R8005:Tsc2	UTSW	17	24599596	missense	probably damaging	0.98
R8262:Tsc2	UTSW	17	24614366	missense	probably benign	0.06
R8268:Tsc2	UTSW	17	24600010	missense	probably benign	0.44
R8400:Tsc2	UTSW	17	24604987	missense	possibly damaging	0.62
Z1177:Tsc2	UTSW	17	24620779	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- ATGCAGTCACCTATCCTCCTGG -3'
(R):5'- TGTTTGTAAGGAGGACGCAG -3'

Sequencing Primer
(F):5'- GTCACCTATCCTCCTGGCACATAAC -3'
(R):5'- ACGCAGTGAACTTGGGATC -3'

Posted On

2016-01-08