Incidental Mutation 'R4114:Vmn2r37'
ID 368258
Institutional Source Beutler Lab
Gene Symbol Vmn2r37
Ensembl Gene ENSMUSG00000066828
Gene Name vomeronasal 2, receptor 37
Synonyms V2r14
MMRRC Submission 040990-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R4114 (G1)
Quality Score 77
Status Validated
Chromosome 7
Chromosomal Location 9205546-9223653 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 9210093 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072787] [ENSMUST00000072787]
AlphaFold F8VQD3
Predicted Effect probably null
Transcript: ENSMUST00000072787
SMART Domains Protein: ENSMUSP00000072566
Gene: ENSMUSG00000066828

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 157 469 2.9e-26 PFAM
Pfam:NCD3G 512 563 1.1e-16 PFAM
Pfam:7tm_3 550 783 1.7e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000072787
SMART Domains Protein: ENSMUSP00000072566
Gene: ENSMUSG00000066828

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 157 469 2.9e-26 PFAM
Pfam:NCD3G 512 563 1.1e-16 PFAM
Pfam:7tm_3 550 783 1.7e-53 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,297,910 V935A probably damaging Het
6030468B19Rik T G 11: 117,802,967 S87A probably damaging Het
Abca16 T C 7: 120,527,067 F1149L probably benign Het
Abcf1 A T 17: 35,959,254 D637E probably benign Het
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
C87977 A T 4: 144,209,603 L29H probably damaging Het
Cdh23 A G 10: 60,421,040 probably null Het
Cep44 T C 8: 56,545,422 T74A probably benign Het
Colq T A 14: 31,557,867 M1L probably benign Het
Cym A T 3: 107,219,749 L30Q probably damaging Het
Dpp6 T A 5: 27,469,487 probably null Het
Gbe1 G T 16: 70,483,827 G372V possibly damaging Het
Hdc T A 2: 126,601,818 M314L probably benign Het
Ino80b A G 6: 83,124,140 S149P probably benign Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mpped1 A G 15: 83,796,709 probably benign Het
Nek5 G A 8: 22,111,162 T181M probably damaging Het
Nlrp4a T G 7: 26,449,940 F324C probably damaging Het
Nop56 T C 2: 130,276,673 probably null Het
Olfr1044 A T 2: 86,171,415 V134D possibly damaging Het
Olfr804 T C 10: 129,705,799 L307S probably benign Het
Pcdhb3 A G 18: 37,302,040 N353S probably benign Het
Pde8a T A 7: 81,282,807 probably null Het
Ryr2 C T 13: 11,692,682 R2823H probably damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Slc7a1 T C 5: 148,342,057 T302A probably damaging Het
Sult2a2 A T 7: 13,734,783 Q58L probably benign Het
Tek T C 4: 94,849,683 S657P probably damaging Het
Trim5 A G 7: 104,265,740 L374P probably damaging Het
Tspan18 C A 2: 93,311,946 probably null Het
Zbbx T C 3: 75,139,598 T121A probably benign Het
Zfp35 A C 18: 24,002,709 I37L probably benign Het
Other mutations in Vmn2r37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Vmn2r37 APN 7 9206681 missense probably benign 0.05
IGL01909:Vmn2r37 APN 7 9216033 nonsense probably null
IGL02281:Vmn2r37 APN 7 9217882 missense possibly damaging 0.95
IGL02282:Vmn2r37 APN 7 9206762 missense probably benign 0.19
IGL02513:Vmn2r37 APN 7 9217935 missense probably benign 0.14
R0136:Vmn2r37 UTSW 7 9217783 nonsense probably null
R2051:Vmn2r37 UTSW 7 9217793 missense probably damaging 1.00
R2262:Vmn2r37 UTSW 7 9217944 missense probably damaging 0.99
R3158:Vmn2r37 UTSW 7 9217714 missense probably benign 0.03
R4084:Vmn2r37 UTSW 7 9215985 missense probably benign
R5231:Vmn2r37 UTSW 7 9206595 missense possibly damaging 0.94
R5462:Vmn2r37 UTSW 7 9217974 missense probably damaging 1.00
R6437:Vmn2r37 UTSW 7 9217851 missense probably damaging 0.98
R7104:Vmn2r37 UTSW 7 9216046 missense probably damaging 1.00
R7116:Vmn2r37 UTSW 7 9217899 missense probably benign 0.00
R7381:Vmn2r37 UTSW 7 9210033 missense probably benign 0.21
R8775:Vmn2r37 UTSW 7 9215992 nonsense probably null
R8775-TAIL:Vmn2r37 UTSW 7 9215992 nonsense probably null
R8869:Vmn2r37 UTSW 7 9206855 missense possibly damaging 0.50
R8884:Vmn2r37 UTSW 7 9215917 missense probably benign
RF004:Vmn2r37 UTSW 7 9217687 missense probably damaging 0.97
Z1177:Vmn2r37 UTSW 7 9209997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTATCCACTCCACACACTTAAG -3'
(R):5'- TTACTAGACACTCAGATACCATGC -3'

Sequencing Primer
(F):5'- TCCACACACTTAAGCAAATAGTG -3'
(R):5'- TCTGAGTTTAAGGCCAGCC -3'
Posted On 2016-01-13