Incidental Mutation 'R4026:Gm7929'
ID368260
Institutional Source Beutler Lab
Gene Symbol Gm7929
Ensembl Gene ENSMUSG00000091740
Gene Namepredicted gene 7929
Synonyms
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4026 (G1)
Quality Score45
Status Validated
Chromosome14
Chromosomal Location41745917-41750614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41750552 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 21 (K21E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178711]
Predicted Effect possibly damaging
Transcript: ENSMUST00000178711
AA Change: E15G

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136129
Gene: ENSMUSG00000091740
AA Change: E15G

DomainStartEndE-ValueType
Pfam:Takusan 50 133 5.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224730
AA Change: K21E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.0424 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ces2g T A 8: 104,964,745 V171E probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm5581 G A 6: 131,167,068 noncoding transcript Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Micu3 A G 8: 40,359,455 probably benign Het
Mrpl3 T C 9: 105,071,486 probably null Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Srsf6 T A 2: 162,934,291 probably benign Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Tlr12 C T 4: 128,616,508 E650K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vmn2r89 T C 14: 51,452,043 M1T probably null Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Predicted Primers PCR Primer
(F):5'- TCTGAAGGATCCAGATCACAATC -3'
(R):5'- CTGATCAAGATGGGGCAAGC -3'

Sequencing Primer
(F):5'- GATCACAATCCCTATTCCTGGAAGG -3'
(R):5'- TAATCCAGTAGGCCATGGAAGTTCC -3'
Posted On2016-01-13