Incidental Mutation 'R4079:Corin'
ID 368271
Institutional Source Beutler Lab
Gene Symbol Corin
Ensembl Gene ENSMUSG00000005220
Gene Name corin, serine peptidase
Synonyms Lrp4
MMRRC Submission 040976-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R4079 (G1)
Quality Score 202
Status Validated
Chromosome 5
Chromosomal Location 72457368-72661816 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72661226 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 89 (D89G)
Ref Sequence ENSEMBL: ENSMUSP00000005352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]
AlphaFold Q9Z319
Predicted Effect probably benign
Transcript: ENSMUST00000005352
AA Change: D89G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: D89G

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
FRI 205 318 6.15e-11 SMART
LDLa 336 372 1.31e-8 SMART
LDLa 373 408 1.5e-8 SMART
LDLa 409 447 5.47e-11 SMART
LDLa 448 484 1.22e-8 SMART
low complexity region 508 521 N/A INTRINSIC
FRI 522 643 2.75e-31 SMART
LDLa 647 684 2.19e-10 SMART
LDLa 685 722 1.76e-5 SMART
LDLa 723 759 4.18e-7 SMART
SR 758 853 3.99e-10 SMART
Tryp_SPc 868 1097 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167460
SMART Domains Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 342 1.5e-8 SMART
LDLa 343 381 5.47e-11 SMART
LDLa 382 418 1.22e-8 SMART
low complexity region 442 455 N/A INTRINSIC
FRI 456 577 2.75e-31 SMART
LDLa 581 618 2.19e-10 SMART
LDLa 619 656 1.76e-5 SMART
LDLa 657 693 4.18e-7 SMART
SR 692 787 3.99e-10 SMART
Tryp_SPc 802 1031 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175766
SMART Domains Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
FRI 137 250 6.15e-11 SMART
LDLa 268 304 1.31e-8 SMART
LDLa 305 343 2.07e-11 SMART
low complexity region 367 380 N/A INTRINSIC
FRI 381 502 2.75e-31 SMART
LDLa 506 543 2.19e-10 SMART
LDLa 544 581 1.76e-5 SMART
LDLa 582 618 4.18e-7 SMART
SR 617 712 3.99e-10 SMART
Tryp_SPc 727 956 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176974
SMART Domains Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 344 3.86e-11 SMART
LDLa 345 381 1.22e-8 SMART
low complexity region 405 418 N/A INTRINSIC
FRI 419 540 2.75e-31 SMART
LDLa 544 581 2.19e-10 SMART
LDLa 582 619 1.76e-5 SMART
LDLa 620 656 4.18e-7 SMART
SR 655 750 3.99e-10 SMART
Tryp_SPc 765 994 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177290
SMART Domains Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 72 185 6.15e-11 SMART
LDLa 203 239 1.31e-8 SMART
LDLa 240 275 1.5e-8 SMART
LDLa 276 314 5.47e-11 SMART
LDLa 315 351 1.22e-8 SMART
low complexity region 375 388 N/A INTRINSIC
FRI 389 510 2.75e-31 SMART
LDLa 514 551 2.19e-10 SMART
LDLa 552 589 1.76e-5 SMART
LDLa 590 626 4.18e-7 SMART
SR 625 720 3.99e-10 SMART
Tryp_SPc 735 964 5.45e-76 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 C G 4: 126,247,473 (GRCm39) probably null Het
Ankfy1 C A 11: 72,580,835 (GRCm39) probably benign Het
Ap4b1 T A 3: 103,720,694 (GRCm39) N121K probably damaging Het
Arhgef12 T C 9: 42,886,588 (GRCm39) M1131V probably damaging Het
Arl5c A T 11: 97,884,327 (GRCm39) I88N probably damaging Het
Armc9 A T 1: 86,140,851 (GRCm39) probably benign Het
Bnc1 T C 7: 81,623,508 (GRCm39) E573G probably damaging Het
Btaf1 A G 19: 36,963,879 (GRCm39) T817A probably benign Het
C3 C T 17: 57,512,303 (GRCm39) D1542N possibly damaging Het
Cadm3 A G 1: 173,169,236 (GRCm39) V293A probably benign Het
Cadps C T 14: 12,457,702 (GRCm38) A1060T probably benign Het
Cbfa2t3 A G 8: 123,374,434 (GRCm39) probably null Het
Ccdc18 C T 5: 108,306,394 (GRCm39) Q270* probably null Het
Cdc45 A T 16: 18,630,110 (GRCm39) V19D probably damaging Het
Cfap57 C A 4: 118,456,194 (GRCm39) S500I probably benign Het
Cnga3 A T 1: 37,280,946 (GRCm39) Q47L possibly damaging Het
Cox16 A T 12: 81,521,109 (GRCm39) probably benign Het
Cyp2a4 A G 7: 26,006,791 (GRCm39) N50S probably benign Het
Diaph1 T A 18: 37,986,636 (GRCm39) E1116D possibly damaging Het
Dlg5 T C 14: 24,198,328 (GRCm39) D1535G possibly damaging Het
Enpp1 A G 10: 24,544,905 (GRCm39) probably null Het
F13b T A 1: 139,429,508 (GRCm39) F9I unknown Het
Fcer1a C T 1: 173,052,920 (GRCm39) C36Y probably damaging Het
Fcho2 A G 13: 98,892,120 (GRCm39) V318A probably damaging Het
Fzd9 A G 5: 135,278,490 (GRCm39) V465A probably benign Het
Hbs1l T C 10: 21,228,501 (GRCm39) V493A probably damaging Het
Hgs T A 11: 120,373,874 (GRCm39) S723T probably benign Het
Hnrnpul1 C T 7: 25,426,300 (GRCm39) R517Q probably damaging Het
Kpna7 A G 5: 144,942,737 (GRCm39) I83T possibly damaging Het
Llgl1 C A 11: 60,601,110 (GRCm39) probably null Het
Lrig3 A C 10: 125,845,656 (GRCm39) E695A probably damaging Het
Lrpap1 A G 5: 35,253,381 (GRCm39) I261T possibly damaging Het
Mfn1 T G 3: 32,596,998 (GRCm39) L152W probably damaging Het
Mog A G 17: 37,323,302 (GRCm39) F212S probably damaging Het
Mpeg1 A G 19: 12,439,634 (GRCm39) N364S probably damaging Het
Mtmr3 C T 11: 4,441,057 (GRCm39) R531Q probably damaging Het
Mx2 A G 16: 97,357,236 (GRCm39) N443S probably damaging Het
Nfatc3 T C 8: 106,806,123 (GRCm39) Y323H probably damaging Het
Nup188 G A 2: 30,199,890 (GRCm39) D305N probably damaging Het
Obscn A G 11: 58,929,189 (GRCm39) V6145A probably benign Het
Or52x1 A T 7: 104,853,228 (GRCm39) H107Q probably damaging Het
Or8u10 A G 2: 85,915,656 (GRCm39) V155A possibly damaging Het
Patl1 C T 19: 11,908,994 (GRCm39) A467V probably damaging Het
Pdss2 A T 10: 43,278,518 (GRCm39) M342L probably benign Het
Phax A G 18: 56,709,051 (GRCm39) N183S possibly damaging Het
Pnck A T X: 72,701,761 (GRCm39) V93E probably damaging Het
Prol1 A G 5: 88,476,075 (GRCm39) N155S unknown Het
Ptprk G A 10: 28,139,508 (GRCm39) V78I probably benign Het
Ptpru A T 4: 131,526,021 (GRCm39) probably null Het
Ptprv A G 1: 135,038,168 (GRCm39) noncoding transcript Het
Ranbp3l A G 15: 9,060,838 (GRCm39) N233S probably damaging Het
Rapgefl1 A G 11: 98,740,803 (GRCm39) T552A probably benign Het
Rasgrp1 A G 2: 117,115,510 (GRCm39) S693P probably benign Het
Scyl2 A T 10: 89,476,458 (GRCm39) M889K probably benign Het
Serpina3a C T 12: 104,085,934 (GRCm39) Q320* probably null Het
Slc12a1 A T 2: 125,042,543 (GRCm39) N733I possibly damaging Het
Snap47 C T 11: 59,319,377 (GRCm39) V254I probably benign Het
Speer4e2 A T 5: 15,027,663 (GRCm39) L71Q probably damaging Het
St6galnac2 A T 11: 116,572,724 (GRCm39) L244Q possibly damaging Het
Syce1 C A 7: 140,359,809 (GRCm39) L83F probably damaging Het
Tjp2 A T 19: 24,086,182 (GRCm39) V780E possibly damaging Het
Tns1 G A 1: 74,034,467 (GRCm39) R192C probably damaging Het
Trav6-3 T C 14: 53,667,537 (GRCm39) L3P possibly damaging Het
Ung G T 5: 114,268,684 (GRCm39) probably null Het
Usp32 T A 11: 84,930,055 (GRCm39) Y574F probably damaging Het
Other mutations in Corin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Corin APN 5 72,462,231 (GRCm39) missense probably damaging 1.00
IGL01114:Corin APN 5 72,462,354 (GRCm39) missense probably damaging 1.00
IGL01351:Corin APN 5 72,496,334 (GRCm39) missense probably damaging 1.00
IGL01516:Corin APN 5 72,611,830 (GRCm39) nonsense probably null
IGL01785:Corin APN 5 72,497,219 (GRCm39) missense probably damaging 1.00
IGL01786:Corin APN 5 72,497,219 (GRCm39) missense probably damaging 1.00
IGL01845:Corin APN 5 72,511,282 (GRCm39) missense probably damaging 1.00
IGL02097:Corin APN 5 72,529,489 (GRCm39) missense probably damaging 1.00
IGL02629:Corin APN 5 72,490,016 (GRCm39) missense probably damaging 1.00
IGL03085:Corin APN 5 72,511,273 (GRCm39) missense probably damaging 1.00
IGL03120:Corin APN 5 72,518,032 (GRCm39) missense probably damaging 1.00
IGL03150:Corin APN 5 72,460,201 (GRCm39) missense probably damaging 1.00
IGL03183:Corin APN 5 72,458,929 (GRCm39) missense probably damaging 0.99
IGL03185:Corin APN 5 72,490,124 (GRCm39) missense probably damaging 1.00
IGL03408:Corin APN 5 72,500,304 (GRCm39) missense probably benign 0.40
alpaca UTSW 5 72,661,295 (GRCm39) missense possibly damaging 0.85
R0078:Corin UTSW 5 72,611,816 (GRCm39) missense possibly damaging 0.77
R0724:Corin UTSW 5 72,490,138 (GRCm39) splice site probably benign
R1065:Corin UTSW 5 72,458,993 (GRCm39) nonsense probably null
R1301:Corin UTSW 5 72,462,276 (GRCm39) missense possibly damaging 0.81
R1466:Corin UTSW 5 72,460,133 (GRCm39) critical splice donor site probably null
R1466:Corin UTSW 5 72,460,133 (GRCm39) critical splice donor site probably null
R1520:Corin UTSW 5 72,488,238 (GRCm39) missense probably damaging 1.00
R1584:Corin UTSW 5 72,460,133 (GRCm39) critical splice donor site probably null
R1617:Corin UTSW 5 72,661,295 (GRCm39) missense possibly damaging 0.85
R1912:Corin UTSW 5 72,515,746 (GRCm39) missense probably damaging 1.00
R2059:Corin UTSW 5 72,473,394 (GRCm39) missense possibly damaging 0.76
R2173:Corin UTSW 5 72,661,422 (GRCm39) missense probably benign 0.01
R2242:Corin UTSW 5 72,490,054 (GRCm39) missense probably damaging 1.00
R2373:Corin UTSW 5 72,496,381 (GRCm39) missense probably damaging 1.00
R2850:Corin UTSW 5 72,462,298 (GRCm39) missense probably damaging 1.00
R3683:Corin UTSW 5 72,488,198 (GRCm39) missense probably damaging 1.00
R3684:Corin UTSW 5 72,488,198 (GRCm39) missense probably damaging 1.00
R3790:Corin UTSW 5 72,592,641 (GRCm39) missense probably benign 0.38
R3847:Corin UTSW 5 72,579,508 (GRCm39) missense probably benign 0.13
R3926:Corin UTSW 5 72,529,473 (GRCm39) missense probably damaging 1.00
R3939:Corin UTSW 5 72,497,222 (GRCm39) missense possibly damaging 0.80
R3945:Corin UTSW 5 72,515,767 (GRCm39) missense probably damaging 1.00
R4224:Corin UTSW 5 72,500,451 (GRCm39) missense probably damaging 1.00
R4473:Corin UTSW 5 72,496,400 (GRCm39) missense probably damaging 1.00
R4585:Corin UTSW 5 72,487,042 (GRCm39) missense probably damaging 1.00
R4586:Corin UTSW 5 72,487,042 (GRCm39) missense probably damaging 1.00
R4849:Corin UTSW 5 72,460,178 (GRCm39) missense probably damaging 1.00
R4926:Corin UTSW 5 72,529,525 (GRCm39) missense probably damaging 1.00
R5080:Corin UTSW 5 72,511,194 (GRCm39) intron probably benign
R5138:Corin UTSW 5 72,496,402 (GRCm39) missense probably damaging 1.00
R5262:Corin UTSW 5 72,462,298 (GRCm39) missense probably damaging 1.00
R5268:Corin UTSW 5 72,500,362 (GRCm39) missense probably damaging 1.00
R5302:Corin UTSW 5 72,473,441 (GRCm39) missense probably benign 0.07
R5307:Corin UTSW 5 72,514,321 (GRCm39) missense probably damaging 1.00
R5324:Corin UTSW 5 72,592,600 (GRCm39) missense probably damaging 1.00
R5352:Corin UTSW 5 72,462,376 (GRCm39) missense probably benign 0.04
R5373:Corin UTSW 5 72,462,296 (GRCm39) missense probably damaging 1.00
R5374:Corin UTSW 5 72,462,296 (GRCm39) missense probably damaging 1.00
R5484:Corin UTSW 5 72,515,827 (GRCm39) missense probably benign 0.15
R5502:Corin UTSW 5 72,473,449 (GRCm39) nonsense probably null
R5544:Corin UTSW 5 72,462,357 (GRCm39) nonsense probably null
R5682:Corin UTSW 5 72,579,497 (GRCm39) missense possibly damaging 0.85
R5818:Corin UTSW 5 72,592,738 (GRCm39) missense probably benign 0.00
R5992:Corin UTSW 5 72,473,732 (GRCm39) missense probably benign 0.01
R6115:Corin UTSW 5 72,518,072 (GRCm39) missense probably damaging 1.00
R6181:Corin UTSW 5 72,529,439 (GRCm39) critical splice donor site probably null
R6317:Corin UTSW 5 72,496,388 (GRCm39) missense probably damaging 1.00
R7053:Corin UTSW 5 72,458,870 (GRCm39) missense probably benign 0.28
R7242:Corin UTSW 5 72,462,398 (GRCm39) missense probably benign 0.14
R7452:Corin UTSW 5 72,592,590 (GRCm39) missense possibly damaging 0.94
R7783:Corin UTSW 5 72,458,967 (GRCm39) missense probably benign 0.26
R7903:Corin UTSW 5 72,458,843 (GRCm39) missense probably benign 0.00
R7956:Corin UTSW 5 72,579,530 (GRCm39) missense probably damaging 0.99
R8007:Corin UTSW 5 72,473,446 (GRCm39) missense probably damaging 0.96
R8125:Corin UTSW 5 72,515,806 (GRCm39) missense probably damaging 0.96
R8215:Corin UTSW 5 72,462,361 (GRCm39) missense probably damaging 1.00
R8251:Corin UTSW 5 72,514,269 (GRCm39) missense probably damaging 1.00
R8364:Corin UTSW 5 72,462,274 (GRCm39) missense probably benign
R8505:Corin UTSW 5 72,592,750 (GRCm39) missense probably benign 0.21
R8746:Corin UTSW 5 72,592,695 (GRCm39) missense probably benign 0.31
R8887:Corin UTSW 5 72,486,953 (GRCm39) critical splice donor site probably null
R9484:Corin UTSW 5 72,497,280 (GRCm39) missense probably damaging 1.00
R9640:Corin UTSW 5 72,592,597 (GRCm39) missense probably benign
Z1177:Corin UTSW 5 72,611,836 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAGTAAGTTCGCGAGCAG -3'
(R):5'- TCATGGGCAGGGTTTCCTTC -3'

Sequencing Primer
(F):5'- TAAGTTCGCGAGCAGGGGAC -3'
(R):5'- CTTGTCCTGGGCGATGCTAC -3'
Posted On 2016-01-15