Mutagenetix > Incidental Mutations

Incidental Mutation 'R4079:Corin'

368271

Institutional Source

Beutler Lab

Gene Symbol

Corin

Ensembl Gene

ENSMUSG00000005220

Gene Name

corin

Synonyms

Lrp4

MMRRC Submission

040976-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.243) question?

Stock #

R4079 (G1)

Quality Score

202

Status

Validated

Chromosome

Chromosomal Location

72300025-72504473 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72503883 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 89 (D89G)

Ref Sequence

ENSEMBL: ENSMUSP00000005352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]

Predicted Effect

probably benign
Transcript: ENSMUST00000005352
AA Change: D89G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: D89G

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
transmembrane domain	113	135	N/A	INTRINSIC
FRI	205	318	6.15e-11	SMART
LDLa	336	372	1.31e-8	SMART
LDLa	373	408	1.5e-8	SMART
LDLa	409	447	5.47e-11	SMART
LDLa	448	484	1.22e-8	SMART
low complexity region	508	521	N/A	INTRINSIC
FRI	522	643	2.75e-31	SMART
LDLa	647	684	2.19e-10	SMART
LDLa	685	722	1.76e-5	SMART
LDLa	723	759	4.18e-7	SMART
SR	758	853	3.99e-10	SMART
Tryp_SPc	868	1097	5.45e-76	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167460

SMART Domains

Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220

Domain	Start	End	E-Value	Type
transmembrane domain	47	69	N/A	INTRINSIC
FRI	139	252	6.15e-11	SMART
LDLa	270	306	1.31e-8	SMART
LDLa	307	342	1.5e-8	SMART
LDLa	343	381	5.47e-11	SMART
LDLa	382	418	1.22e-8	SMART
low complexity region	442	455	N/A	INTRINSIC
FRI	456	577	2.75e-31	SMART
LDLa	581	618	2.19e-10	SMART
LDLa	619	656	1.76e-5	SMART
LDLa	657	693	4.18e-7	SMART
SR	692	787	3.99e-10	SMART
Tryp_SPc	802	1031	5.45e-76	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000175766

SMART Domains

Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220

Domain	Start	End	E-Value	Type
transmembrane domain	45	67	N/A	INTRINSIC
FRI	137	250	6.15e-11	SMART
LDLa	268	304	1.31e-8	SMART
LDLa	305	343	2.07e-11	SMART
low complexity region	367	380	N/A	INTRINSIC
FRI	381	502	2.75e-31	SMART
LDLa	506	543	2.19e-10	SMART
LDLa	544	581	1.76e-5	SMART
LDLa	582	618	4.18e-7	SMART
SR	617	712	3.99e-10	SMART
Tryp_SPc	727	956	5.45e-76	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176974

SMART Domains

Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220

Domain	Start	End	E-Value	Type
transmembrane domain	47	69	N/A	INTRINSIC
FRI	139	252	6.15e-11	SMART
LDLa	270	306	1.31e-8	SMART
LDLa	307	344	3.86e-11	SMART
LDLa	345	381	1.22e-8	SMART
low complexity region	405	418	N/A	INTRINSIC
FRI	419	540	2.75e-31	SMART
LDLa	544	581	2.19e-10	SMART
LDLa	582	619	1.76e-5	SMART
LDLa	620	656	4.18e-7	SMART
SR	655	750	3.99e-10	SMART
Tryp_SPc	765	994	5.45e-76	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177290

SMART Domains

Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220

Domain	Start	End	E-Value	Type
transmembrane domain	47	69	N/A	INTRINSIC
FRI	72	185	6.15e-11	SMART
LDLa	203	239	1.31e-8	SMART
LDLa	240	275	1.5e-8	SMART
LDLa	276	314	5.47e-11	SMART
LDLa	315	351	1.22e-8	SMART
low complexity region	375	388	N/A	INTRINSIC
FRI	389	510	2.75e-31	SMART
LDLa	514	551	2.19e-10	SMART
LDLa	552	589	1.76e-5	SMART
LDLa	590	626	4.18e-7	SMART
SR	625	720	3.99e-10	SMART
Tryp_SPc	735	964	5.45e-76	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago3	C	G	4: 126,353,680		probably null	Het
Ankfy1	C	A	11: 72,690,009		probably benign	Het
Ap4b1	T	A	3: 103,813,378	N121K	probably damaging	Het
Arhgef12	T	C	9: 42,975,292	M1131V	probably damaging	Het
Arl5c	A	T	11: 97,993,501	I88N	probably damaging	Het
Armc9	A	T	1: 86,213,129		probably benign	Het
Bnc1	T	C	7: 81,973,760	E573G	probably damaging	Het
Btaf1	A	G	19: 36,986,479	T817A	probably benign	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cadm3	A	G	1: 173,341,669	V293A	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cbfa2t3	A	G	8: 122,647,695		probably null	Het
Ccdc18	C	T	5: 108,158,528	Q270*	probably null	Het
Cdc45	A	T	16: 18,811,360	V19D	probably damaging	Het
Cfap57	C	A	4: 118,598,997	S500I	probably benign	Het
Cnga3	A	T	1: 37,241,865	Q47L	possibly damaging	Het
Cox16	A	T	12: 81,474,335		probably benign	Het
Cyp2a4	A	G	7: 26,307,366	N50S	probably benign	Het
Diaph1	T	A	18: 37,853,583	E1116D	possibly damaging	Het
Dlg5	T	C	14: 24,148,260	D1535G	possibly damaging	Het
Enpp1	A	G	10: 24,669,007		probably null	Het
F13b	T	A	1: 139,501,770	F9I	unknown	Het
Fcer1a	C	T	1: 173,225,353	C36Y	probably damaging	Het
Fcho2	A	G	13: 98,755,612	V318A	probably damaging	Het
Fzd9	A	G	5: 135,249,636	V465A	probably benign	Het
Gm10354	A	T	5: 14,977,649	L71Q	probably damaging	Het
Hbs1l	T	C	10: 21,352,602	V493A	probably damaging	Het
Hgs	T	A	11: 120,483,048	S723T	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Kpna7	A	G	5: 145,005,927	I83T	possibly damaging	Het
Llgl1	C	A	11: 60,710,284		probably null	Het
Lrig3	A	C	10: 126,009,787	E695A	probably damaging	Het
Lrpap1	A	G	5: 35,096,037	I261T	possibly damaging	Het
Mfn1	T	G	3: 32,542,849	L152W	probably damaging	Het
Mog	A	G	17: 37,012,410	F212S	probably damaging	Het
Mpeg1	A	G	19: 12,462,270	N364S	probably damaging	Het
Mtmr3	C	T	11: 4,491,057	R531Q	probably damaging	Het
Mx2	A	G	16: 97,556,036	N443S	probably damaging	Het
Nfatc3	T	C	8: 106,079,491	Y323H	probably damaging	Het
Nup188	G	A	2: 30,309,878	D305N	probably damaging	Het
Obscn	A	G	11: 59,038,363	V6145A	probably benign	Het
Olfr1037	A	G	2: 86,085,312	V155A	possibly damaging	Het
Olfr686	A	T	7: 105,204,021	H107Q	probably damaging	Het
Patl1	C	T	19: 11,931,630	A467V	probably damaging	Het
Pdss2	A	T	10: 43,402,522	M342L	probably benign	Het
Phax	A	G	18: 56,575,979	N183S	possibly damaging	Het
Pnck	A	T	X: 73,658,155	V93E	probably damaging	Het
Prol1	A	G	5: 88,328,216	N155S	unknown	Het
Ptprk	G	A	10: 28,263,512	V78I	probably benign	Het
Ptpru	A	T	4: 131,798,710		probably null	Het
Ptprv	A	G	1: 135,110,430		noncoding transcript	Het
Ranbp3l	A	G	15: 9,060,757	N233S	probably damaging	Het
Rapgefl1	A	G	11: 98,849,977	T552A	probably benign	Het
Rasgrp1	A	G	2: 117,285,029	S693P	probably benign	Het
Scyl2	A	T	10: 89,640,596	M889K	probably benign	Het
Serpina3a	C	T	12: 104,119,675	Q320*	probably null	Het
Slc12a1	A	T	2: 125,200,623	N733I	possibly damaging	Het
Snap47	C	T	11: 59,428,551	V254I	probably benign	Het
St6galnac2	A	T	11: 116,681,898	L244Q	possibly damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tjp2	A	T	19: 24,108,818	V780E	possibly damaging	Het
Tns1	G	A	1: 73,995,308	R192C	probably damaging	Het
Trav6-3	T	C	14: 53,430,080	L3P	possibly damaging	Het
Ung	G	T	5: 114,130,623		probably null	Het
Usp32	T	A	11: 85,039,229	Y574F	probably damaging	Het

Other mutations in Corin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00557:Corin	APN	5	72304888	missense	probably damaging	1.00
IGL01114:Corin	APN	5	72305011	missense	probably damaging	1.00
IGL01351:Corin	APN	5	72338991	missense	probably damaging	1.00
IGL01516:Corin	APN	5	72454487	nonsense	probably null
IGL01785:Corin	APN	5	72339876	missense	probably damaging	1.00
IGL01786:Corin	APN	5	72339876	missense	probably damaging	1.00
IGL01845:Corin	APN	5	72353939	missense	probably damaging	1.00
IGL02097:Corin	APN	5	72372146	missense	probably damaging	1.00
IGL02629:Corin	APN	5	72332673	missense	probably damaging	1.00
IGL03085:Corin	APN	5	72353930	missense	probably damaging	1.00
IGL03120:Corin	APN	5	72360689	missense	probably damaging	1.00
IGL03150:Corin	APN	5	72302858	missense	probably damaging	1.00
IGL03183:Corin	APN	5	72301586	missense	probably damaging	0.99
IGL03185:Corin	APN	5	72332781	missense	probably damaging	1.00
IGL03408:Corin	APN	5	72342961	missense	probably benign	0.40
alpaca	UTSW	5	72503952	missense	possibly damaging	0.85
R0078:Corin	UTSW	5	72454473	missense	possibly damaging	0.77
R0724:Corin	UTSW	5	72332795	splice site	probably benign
R1065:Corin	UTSW	5	72301650	nonsense	probably null
R1301:Corin	UTSW	5	72304933	missense	possibly damaging	0.81
R1466:Corin	UTSW	5	72302790	critical splice donor site	probably null
R1466:Corin	UTSW	5	72302790	critical splice donor site	probably null
R1520:Corin	UTSW	5	72330895	missense	probably damaging	1.00
R1584:Corin	UTSW	5	72302790	critical splice donor site	probably null
R1617:Corin	UTSW	5	72503952	missense	possibly damaging	0.85
R1912:Corin	UTSW	5	72358403	missense	probably damaging	1.00
R2059:Corin	UTSW	5	72316051	missense	possibly damaging	0.76
R2173:Corin	UTSW	5	72504079	missense	probably benign	0.01
R2242:Corin	UTSW	5	72332711	missense	probably damaging	1.00
R2373:Corin	UTSW	5	72339038	missense	probably damaging	1.00
R2850:Corin	UTSW	5	72304955	missense	probably damaging	1.00
R3683:Corin	UTSW	5	72330855	missense	probably damaging	1.00
R3684:Corin	UTSW	5	72330855	missense	probably damaging	1.00
R3790:Corin	UTSW	5	72435298	missense	probably benign	0.38
R3847:Corin	UTSW	5	72422165	missense	probably benign	0.13
R3926:Corin	UTSW	5	72372130	missense	probably damaging	1.00
R3939:Corin	UTSW	5	72339879	missense	possibly damaging	0.80
R3945:Corin	UTSW	5	72358424	missense	probably damaging	1.00
R4224:Corin	UTSW	5	72343108	missense	probably damaging	1.00
R4473:Corin	UTSW	5	72339057	missense	probably damaging	1.00
R4585:Corin	UTSW	5	72329699	missense	probably damaging	1.00
R4586:Corin	UTSW	5	72329699	missense	probably damaging	1.00
R4849:Corin	UTSW	5	72302835	missense	probably damaging	1.00
R4926:Corin	UTSW	5	72372182	missense	probably damaging	1.00
R5080:Corin	UTSW	5	72353851	intron	probably benign
R5138:Corin	UTSW	5	72339059	missense	probably damaging	1.00
R5262:Corin	UTSW	5	72304955	missense	probably damaging	1.00
R5268:Corin	UTSW	5	72343019	missense	probably damaging	1.00
R5302:Corin	UTSW	5	72316098	missense	probably benign	0.07
R5307:Corin	UTSW	5	72356978	missense	probably damaging	1.00
R5324:Corin	UTSW	5	72435257	missense	probably damaging	1.00
R5352:Corin	UTSW	5	72305033	missense	probably benign	0.04
R5373:Corin	UTSW	5	72304953	missense	probably damaging	1.00
R5374:Corin	UTSW	5	72304953	missense	probably damaging	1.00
R5484:Corin	UTSW	5	72358484	missense	probably benign	0.15
R5502:Corin	UTSW	5	72316106	nonsense	probably null
R5544:Corin	UTSW	5	72305014	nonsense	probably null
R5682:Corin	UTSW	5	72422154	missense	possibly damaging	0.85
R5818:Corin	UTSW	5	72435395	missense	probably benign	0.00
R5992:Corin	UTSW	5	72316389	missense	probably benign	0.01
R6115:Corin	UTSW	5	72360729	missense	probably damaging	1.00
R6181:Corin	UTSW	5	72372096	critical splice donor site	probably null
R6317:Corin	UTSW	5	72339045	missense	probably damaging	1.00
R7053:Corin	UTSW	5	72301527	missense	probably benign	0.28
R7242:Corin	UTSW	5	72305055	missense	probably benign	0.14
R7452:Corin	UTSW	5	72435247	missense	possibly damaging	0.94
R7783:Corin	UTSW	5	72301624	missense	probably benign	0.26
R7903:Corin	UTSW	5	72301500	missense	probably benign	0.00
R7986:Corin	UTSW	5	72301500	missense	probably benign	0.00
R8007:Corin	UTSW	5	72316103	missense	not run
Z1177:Corin	UTSW	5	72454493	missense	not run

Predicted Primers

PCR Primer
(F):5'- CAGAGTAAGTTCGCGAGCAG -3'
(R):5'- TCATGGGCAGGGTTTCCTTC -3'

Sequencing Primer
(F):5'- TAAGTTCGCGAGCAGGGGAC -3'
(R):5'- CTTGTCCTGGGCGATGCTAC -3'

Posted On

2016-01-15