Mutagenetix > Incidental Mutations

Incidental Mutation 'R4079:Lrig3'

368273

Institutional Source

Beutler Lab

Gene Symbol

Lrig3

Ensembl Gene

ENSMUSG00000020105

Gene Name

leucine-rich repeats and immunoglobulin-like domains 3

Synonyms

9030421L11Rik, 9430095K15Rik, 9130004I02Rik

MMRRC Submission

040976-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.256) question?

Stock #

R4079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125966168-126015359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 126009787 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 695 (E695A)

Ref Sequence

ENSEMBL: ENSMUSP00000074360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074807]

PDB Structure

Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000074807
AA Change: E695A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: E695A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LRRNT	46	78	6.74e-2	SMART
LRR	72	96	4.45e1	SMART
LRR	97	120	1.06e1	SMART
LRR	144	166	1.14e0	SMART
LRR	168	189	1.62e2	SMART
LRR	190	214	1.09e1	SMART
LRR	215	237	1.71e1	SMART
LRR	238	261	2.29e0	SMART
LRR	262	285	3.07e-1	SMART
LRR	286	309	2.49e-1	SMART
LRR	310	333	1.29e1	SMART
LRR	334	357	6.22e0	SMART
LRR	358	384	6.05e0	SMART
LRR_TYP	385	408	1.56e-2	SMART
LRR_TYP	409	432	1.79e-2	SMART
LRRCT	444	494	2.35e-7	SMART
IGc2	511	588	1.65e-4	SMART
IGc2	615	683	1.33e-8	SMART
IGc2	709	774	2.78e-11	SMART
transmembrane domain	805	827	N/A	INTRINSIC
low complexity region	1069	1081	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218580

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219974

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220332

Meta Mutation Damage Score

0.7627

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago3	C	G	4: 126,353,680		probably null	Het
Ankfy1	C	A	11: 72,690,009		probably benign	Het
Ap4b1	T	A	3: 103,813,378	N121K	probably damaging	Het
Arhgef12	T	C	9: 42,975,292	M1131V	probably damaging	Het
Arl5c	A	T	11: 97,993,501	I88N	probably damaging	Het
Armc9	A	T	1: 86,213,129		probably benign	Het
Bnc1	T	C	7: 81,973,760	E573G	probably damaging	Het
Btaf1	A	G	19: 36,986,479	T817A	probably benign	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cadm3	A	G	1: 173,341,669	V293A	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cbfa2t3	A	G	8: 122,647,695		probably null	Het
Ccdc18	C	T	5: 108,158,528	Q270*	probably null	Het
Cdc45	A	T	16: 18,811,360	V19D	probably damaging	Het
Cfap57	C	A	4: 118,598,997	S500I	probably benign	Het
Cnga3	A	T	1: 37,241,865	Q47L	possibly damaging	Het
Corin	T	C	5: 72,503,883	D89G	probably benign	Het
Cox16	A	T	12: 81,474,335		probably benign	Het
Cyp2a4	A	G	7: 26,307,366	N50S	probably benign	Het
Diaph1	T	A	18: 37,853,583	E1116D	possibly damaging	Het
Dlg5	T	C	14: 24,148,260	D1535G	possibly damaging	Het
Enpp1	A	G	10: 24,669,007		probably null	Het
F13b	T	A	1: 139,501,770	F9I	unknown	Het
Fcer1a	C	T	1: 173,225,353	C36Y	probably damaging	Het
Fcho2	A	G	13: 98,755,612	V318A	probably damaging	Het
Fzd9	A	G	5: 135,249,636	V465A	probably benign	Het
Gm10354	A	T	5: 14,977,649	L71Q	probably damaging	Het
Hbs1l	T	C	10: 21,352,602	V493A	probably damaging	Het
Hgs	T	A	11: 120,483,048	S723T	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Kpna7	A	G	5: 145,005,927	I83T	possibly damaging	Het
Llgl1	C	A	11: 60,710,284		probably null	Het
Lrpap1	A	G	5: 35,096,037	I261T	possibly damaging	Het
Mfn1	T	G	3: 32,542,849	L152W	probably damaging	Het
Mog	A	G	17: 37,012,410	F212S	probably damaging	Het
Mpeg1	A	G	19: 12,462,270	N364S	probably damaging	Het
Mtmr3	C	T	11: 4,491,057	R531Q	probably damaging	Het
Mx2	A	G	16: 97,556,036	N443S	probably damaging	Het
Nfatc3	T	C	8: 106,079,491	Y323H	probably damaging	Het
Nup188	G	A	2: 30,309,878	D305N	probably damaging	Het
Obscn	A	G	11: 59,038,363	V6145A	probably benign	Het
Olfr1037	A	G	2: 86,085,312	V155A	possibly damaging	Het
Olfr686	A	T	7: 105,204,021	H107Q	probably damaging	Het
Patl1	C	T	19: 11,931,630	A467V	probably damaging	Het
Pdss2	A	T	10: 43,402,522	M342L	probably benign	Het
Phax	A	G	18: 56,575,979	N183S	possibly damaging	Het
Pnck	A	T	X: 73,658,155	V93E	probably damaging	Het
Prol1	A	G	5: 88,328,216	N155S	unknown	Het
Ptprk	G	A	10: 28,263,512	V78I	probably benign	Het
Ptpru	A	T	4: 131,798,710		probably null	Het
Ptprv	A	G	1: 135,110,430		noncoding transcript	Het
Ranbp3l	A	G	15: 9,060,757	N233S	probably damaging	Het
Rapgefl1	A	G	11: 98,849,977	T552A	probably benign	Het
Rasgrp1	A	G	2: 117,285,029	S693P	probably benign	Het
Scyl2	A	T	10: 89,640,596	M889K	probably benign	Het
Serpina3a	C	T	12: 104,119,675	Q320*	probably null	Het
Slc12a1	A	T	2: 125,200,623	N733I	possibly damaging	Het
Snap47	C	T	11: 59,428,551	V254I	probably benign	Het
St6galnac2	A	T	11: 116,681,898	L244Q	possibly damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tjp2	A	T	19: 24,108,818	V780E	possibly damaging	Het
Tns1	G	A	1: 73,995,308	R192C	probably damaging	Het
Trav6-3	T	C	14: 53,430,080	L3P	possibly damaging	Het
Ung	G	T	5: 114,130,623		probably null	Het
Usp32	T	A	11: 85,039,229	Y574F	probably damaging	Het

Other mutations in Lrig3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Lrig3	APN	10	126013148	missense	probably benign	0.00
IGL00426:Lrig3	APN	10	125972137	nonsense	probably null
IGL00969:Lrig3	APN	10	125997115	missense	probably damaging	1.00
IGL01376:Lrig3	APN	10	125994466	missense	probably benign	0.01
IGL01510:Lrig3	APN	10	126008698	missense	probably damaging	1.00
IGL01825:Lrig3	APN	10	126010017	missense	probably damaging	0.98
IGL02231:Lrig3	APN	10	125997172	missense	probably damaging	1.00
IGL02377:Lrig3	APN	10	126014874	missense	probably benign	0.00
IGL02648:Lrig3	APN	10	125966594	missense	probably benign
IGL02832:Lrig3	APN	10	126007002	missense	probably benign	0.37
IGL03266:Lrig3	APN	10	126013282	missense	probably benign	0.28
R0023:Lrig3	UTSW	10	126010219	missense	probably damaging	1.00
R0129:Lrig3	UTSW	10	126006943	missense	probably damaging	1.00
R0183:Lrig3	UTSW	10	126010192	missense	probably damaging	1.00
R0226:Lrig3	UTSW	10	125972117	splice site	probably benign
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0336:Lrig3	UTSW	10	125966705	missense	probably benign	0.04
R0348:Lrig3	UTSW	10	126013448	nonsense	probably null
R0502:Lrig3	UTSW	10	126008736	missense	probably damaging	1.00
R0639:Lrig3	UTSW	10	126010221	missense	probably damaging	1.00
R1099:Lrig3	UTSW	10	126007014	splice site	probably null
R1220:Lrig3	UTSW	10	125997076	missense	probably damaging	1.00
R1230:Lrig3	UTSW	10	126002971	missense	probably damaging	1.00
R1398:Lrig3	UTSW	10	126003088	missense	probably benign	0.00
R1451:Lrig3	UTSW	10	126010057	missense	possibly damaging	0.92
R1523:Lrig3	UTSW	10	126008698	missense	probably damaging	1.00
R1545:Lrig3	UTSW	10	126008547	missense	possibly damaging	0.80
R1661:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1665:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1673:Lrig3	UTSW	10	126010167	missense	probably damaging	1.00
R1778:Lrig3	UTSW	10	126010075	missense	probably damaging	1.00
R1800:Lrig3	UTSW	10	125997051	splice site	probably null
R1840:Lrig3	UTSW	10	126013389	nonsense	probably null
R1882:Lrig3	UTSW	10	126009825	missense	possibly damaging	0.89
R1900:Lrig3	UTSW	10	126002393	splice site	probably benign
R2160:Lrig3	UTSW	10	125997696	missense	possibly damaging	0.95
R2200:Lrig3	UTSW	10	125996609	splice site	probably null
R2294:Lrig3	UTSW	10	125966494	nonsense	probably null
R2518:Lrig3	UTSW	10	125994441	missense	probably benign	0.07
R3037:Lrig3	UTSW	10	126010032	missense	probably damaging	1.00
R3236:Lrig3	UTSW	10	125997187	missense	probably damaging	1.00
R4073:Lrig3	UTSW	10	126013408	missense	probably benign
R4074:Lrig3	UTSW	10	126013408	missense	probably benign
R4075:Lrig3	UTSW	10	126013408	missense	probably benign
R4077:Lrig3	UTSW	10	126009787	missense	probably damaging	1.00
R4405:Lrig3	UTSW	10	126011008	missense	probably benign	0.00
R4425:Lrig3	UTSW	10	126013404	missense	probably benign	0.00
R4505:Lrig3	UTSW	10	126013347	missense	probably benign	0.00
R4860:Lrig3	UTSW	10	126011052	missense	probably benign	0.36
R4860:Lrig3	UTSW	10	126011052	missense	probably benign	0.36
R4903:Lrig3	UTSW	10	125996613	critical splice acceptor site	probably null
R5201:Lrig3	UTSW	10	126013151	missense	possibly damaging	0.48
R5307:Lrig3	UTSW	10	126006690	missense	probably damaging	1.00
R5402:Lrig3	UTSW	10	126008740	missense	probably damaging	1.00
R5557:Lrig3	UTSW	10	125972134	missense	probably damaging	1.00
R5792:Lrig3	UTSW	10	126009919	missense	probably damaging	1.00
R5903:Lrig3	UTSW	10	126008478	missense	probably damaging	1.00
R6280:Lrig3	UTSW	10	126010979	missense	probably benign	0.18
R6484:Lrig3	UTSW	10	125996609	splice site	probably null
R6985:Lrig3	UTSW	10	126014869	missense	possibly damaging	0.64
R7089:Lrig3	UTSW	10	125997124	missense	probably damaging	1.00
R7177:Lrig3	UTSW	10	126006843	missense	probably benign	0.02
R7347:Lrig3	UTSW	10	126009966	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTTTGACCCTTAACCTGGTGG -3'
(R):5'- TCACACGTGTATTTCCCGGC -3'

Sequencing Primer
(F):5'- CCTTAACCTGGTGGGAGGAG -3'
(R):5'- CACGATGATCAGCAGCTGGTTG -3'

Posted On

2016-01-15