Incidental Mutation 'R4079:Pnck'
ID 368277
Institutional Source Beutler Lab
Gene Symbol Pnck
Ensembl Gene ENSMUSG00000002012
Gene Name pregnancy upregulated non-ubiquitously expressed CaM kinase
Synonyms Punc, Bstk3, CaMKIbeta2, Camk1b
MMRRC Submission 040976-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4079 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 72699600-72703723 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 72701761 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 93 (V93E)
Ref Sequence ENSEMBL: ENSMUSP00000120453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002087] [ENSMUST00000114472] [ENSMUST00000114473] [ENSMUST00000144187]
AlphaFold Q9QYK9
Predicted Effect probably damaging
Transcript: ENSMUST00000002087
AA Change: V93E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002087
Gene: ENSMUSG00000002012
AA Change: V93E

DomainStartEndE-ValueType
S_TKc 15 270 1.05e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114472
AA Change: V93E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110116
Gene: ENSMUSG00000002012
AA Change: V93E

DomainStartEndE-ValueType
S_TKc 15 270 1.05e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114473
AA Change: V93E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110117
Gene: ENSMUSG00000002012
AA Change: V93E

DomainStartEndE-ValueType
S_TKc 15 270 1.05e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129106
Predicted Effect probably damaging
Transcript: ENSMUST00000144187
AA Change: V93E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120453
Gene: ENSMUSG00000002012
AA Change: V93E

DomainStartEndE-ValueType
S_TKc 15 226 2.52e-70 SMART
Meta Mutation Damage Score 0.7885 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PNCK is a member of the calcium/calmodulin-dependent protein kinase family of protein serine/threonine kinases (see CAMK1; MIM 604998) (Gardner et al., 2000 [PubMed 10673339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 C G 4: 126,247,473 (GRCm39) probably null Het
Ankfy1 C A 11: 72,580,835 (GRCm39) probably benign Het
Ap4b1 T A 3: 103,720,694 (GRCm39) N121K probably damaging Het
Arhgef12 T C 9: 42,886,588 (GRCm39) M1131V probably damaging Het
Arl5c A T 11: 97,884,327 (GRCm39) I88N probably damaging Het
Armc9 A T 1: 86,140,851 (GRCm39) probably benign Het
Bnc1 T C 7: 81,623,508 (GRCm39) E573G probably damaging Het
Btaf1 A G 19: 36,963,879 (GRCm39) T817A probably benign Het
C3 C T 17: 57,512,303 (GRCm39) D1542N possibly damaging Het
Cadm3 A G 1: 173,169,236 (GRCm39) V293A probably benign Het
Cadps C T 14: 12,457,702 (GRCm38) A1060T probably benign Het
Cbfa2t3 A G 8: 123,374,434 (GRCm39) probably null Het
Ccdc18 C T 5: 108,306,394 (GRCm39) Q270* probably null Het
Cdc45 A T 16: 18,630,110 (GRCm39) V19D probably damaging Het
Cfap57 C A 4: 118,456,194 (GRCm39) S500I probably benign Het
Cnga3 A T 1: 37,280,946 (GRCm39) Q47L possibly damaging Het
Corin T C 5: 72,661,226 (GRCm39) D89G probably benign Het
Cox16 A T 12: 81,521,109 (GRCm39) probably benign Het
Cyp2a4 A G 7: 26,006,791 (GRCm39) N50S probably benign Het
Diaph1 T A 18: 37,986,636 (GRCm39) E1116D possibly damaging Het
Dlg5 T C 14: 24,198,328 (GRCm39) D1535G possibly damaging Het
Enpp1 A G 10: 24,544,905 (GRCm39) probably null Het
F13b T A 1: 139,429,508 (GRCm39) F9I unknown Het
Fcer1a C T 1: 173,052,920 (GRCm39) C36Y probably damaging Het
Fcho2 A G 13: 98,892,120 (GRCm39) V318A probably damaging Het
Fzd9 A G 5: 135,278,490 (GRCm39) V465A probably benign Het
Hbs1l T C 10: 21,228,501 (GRCm39) V493A probably damaging Het
Hgs T A 11: 120,373,874 (GRCm39) S723T probably benign Het
Hnrnpul1 C T 7: 25,426,300 (GRCm39) R517Q probably damaging Het
Kpna7 A G 5: 144,942,737 (GRCm39) I83T possibly damaging Het
Llgl1 C A 11: 60,601,110 (GRCm39) probably null Het
Lrig3 A C 10: 125,845,656 (GRCm39) E695A probably damaging Het
Lrpap1 A G 5: 35,253,381 (GRCm39) I261T possibly damaging Het
Mfn1 T G 3: 32,596,998 (GRCm39) L152W probably damaging Het
Mog A G 17: 37,323,302 (GRCm39) F212S probably damaging Het
Mpeg1 A G 19: 12,439,634 (GRCm39) N364S probably damaging Het
Mtmr3 C T 11: 4,441,057 (GRCm39) R531Q probably damaging Het
Mx2 A G 16: 97,357,236 (GRCm39) N443S probably damaging Het
Nfatc3 T C 8: 106,806,123 (GRCm39) Y323H probably damaging Het
Nup188 G A 2: 30,199,890 (GRCm39) D305N probably damaging Het
Obscn A G 11: 58,929,189 (GRCm39) V6145A probably benign Het
Or52x1 A T 7: 104,853,228 (GRCm39) H107Q probably damaging Het
Or8u10 A G 2: 85,915,656 (GRCm39) V155A possibly damaging Het
Patl1 C T 19: 11,908,994 (GRCm39) A467V probably damaging Het
Pdss2 A T 10: 43,278,518 (GRCm39) M342L probably benign Het
Phax A G 18: 56,709,051 (GRCm39) N183S possibly damaging Het
Prol1 A G 5: 88,476,075 (GRCm39) N155S unknown Het
Ptprk G A 10: 28,139,508 (GRCm39) V78I probably benign Het
Ptpru A T 4: 131,526,021 (GRCm39) probably null Het
Ptprv A G 1: 135,038,168 (GRCm39) noncoding transcript Het
Ranbp3l A G 15: 9,060,838 (GRCm39) N233S probably damaging Het
Rapgefl1 A G 11: 98,740,803 (GRCm39) T552A probably benign Het
Rasgrp1 A G 2: 117,115,510 (GRCm39) S693P probably benign Het
Scyl2 A T 10: 89,476,458 (GRCm39) M889K probably benign Het
Serpina3a C T 12: 104,085,934 (GRCm39) Q320* probably null Het
Slc12a1 A T 2: 125,042,543 (GRCm39) N733I possibly damaging Het
Snap47 C T 11: 59,319,377 (GRCm39) V254I probably benign Het
Speer4e2 A T 5: 15,027,663 (GRCm39) L71Q probably damaging Het
St6galnac2 A T 11: 116,572,724 (GRCm39) L244Q possibly damaging Het
Syce1 C A 7: 140,359,809 (GRCm39) L83F probably damaging Het
Tjp2 A T 19: 24,086,182 (GRCm39) V780E possibly damaging Het
Tns1 G A 1: 74,034,467 (GRCm39) R192C probably damaging Het
Trav6-3 T C 14: 53,667,537 (GRCm39) L3P possibly damaging Het
Ung G T 5: 114,268,684 (GRCm39) probably null Het
Usp32 T A 11: 84,930,055 (GRCm39) Y574F probably damaging Het
Other mutations in Pnck
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3808:Pnck UTSW X 72,700,550 (GRCm39) missense probably damaging 1.00
R4077:Pnck UTSW X 72,701,761 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTCAAGTCCAAATGTAAGTGG -3'
(R):5'- AAGCTCCAGTGATCCATCAGG -3'

Sequencing Primer
(F):5'- CTCAAGTCCAAATGTAAGTGGGATAG -3'
(R):5'- GAGCCTTTTCTCTGTTTCAGAATCAG -3'
Posted On 2016-01-15