Incidental Mutation 'R4049:Mroh2a'
ID368286
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Namemaestro heat-like repeat family member 2A
SynonymsHeatr7b1, ENSMUSG00000044873, OTTMUSG00000020804
MMRRC Submission 041616-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R4049 (G1)
Quality Score31
Status Validated
Chromosome1
Chromosomal Location88226986-88262289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88258664 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 64 (S64G)
Ref Sequence ENSEMBL: ENSMUSP00000118971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000113130] [ENSMUST00000135948]
Predicted Effect probably benign
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
AA Change: S1567G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: S1567G

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113130
AA Change: S1559G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: S1559G

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135948
AA Change: S64G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000118971
Gene: ENSMUSG00000079429
AA Change: S64G

DomainStartEndE-ValueType
SCOP:d1gw5a_ 15 174 5e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Blm T A 7: 80,502,862 T446S probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Eral1 A G 11: 78,075,602 L250P probably damaging Het
Gdf15 A T 8: 70,629,955 M167K probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Herc3 A G 6: 58,876,837 I623V probably damaging Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map1lc3a G T 2: 155,277,542 V91F possibly damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Oprm1 G A 10: 6,829,087 V95I probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Plekha5 T C 6: 140,583,871 S75P probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rai14 T C 15: 10,592,212 N199S probably benign Het
Rasgrp2 T C 19: 6,404,727 L199P probably damaging Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Srsf4 T C 4: 131,900,543 probably benign Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Thsd1 T A 8: 22,243,164 Y76N possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Trim37 T A 11: 87,140,603 probably null Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88230746 missense probably damaging 0.99
IGL00990:Mroh2a APN 1 88244970 missense probably benign 0.03
IGL00990:Mroh2a APN 1 88234120 missense possibly damaging 0.76
IGL03097:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R0032:Mroh2a UTSW 1 88256166 frame shift probably null
R0068:Mroh2a UTSW 1 88256166 frame shift probably null
R0139:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88230680 nonsense probably null
R0374:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0387:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R0536:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0548:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88256166 frame shift probably null
R0583:Mroh2a UTSW 1 88256166 frame shift probably null
R0613:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88230680 nonsense probably null
R0657:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0671:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0675:Mroh2a UTSW 1 88228380 missense probably damaging 0.99
R0675:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0689:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0689:Mroh2a UTSW 1 88230680 nonsense probably null
R0735:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88230680 nonsense probably null
R0845:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0853:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0959:Mroh2a UTSW 1 88232257 frame shift probably null
R0960:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1028:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1268:Mroh2a UTSW 1 88230680 nonsense probably null
R1281:Mroh2a UTSW 1 88256167 frame shift probably null
R1414:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1439:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1441:Mroh2a UTSW 1 88241631 missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1442:Mroh2a UTSW 1 88232353 splice site probably benign
R1465:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1662:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R1686:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1686:Mroh2a UTSW 1 88230680 nonsense probably null
R1780:Mroh2a UTSW 1 88230680 nonsense probably null
R1846:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1899:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1958:Mroh2a UTSW 1 88237491 nonsense probably null
R2122:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2248:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2306:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R2869:Mroh2a UTSW 1 88232257 frame shift probably null
R2870:Mroh2a UTSW 1 88232257 frame shift probably null
R2871:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88232257 frame shift probably null
R3408:Mroh2a UTSW 1 88232257 frame shift probably null
R3608:Mroh2a UTSW 1 88244995 missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88232257 frame shift probably null
R3937:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4022:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R4133:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88259589 missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4625:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4665:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4701:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4701:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R4771:Mroh2a UTSW 1 88251365 missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4839:Mroh2a UTSW 1 88237944 missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R5007:Mroh2a UTSW 1 88232257 frame shift probably null
R5031:Mroh2a UTSW 1 88232257 frame shift probably null
R5062:Mroh2a UTSW 1 88232257 frame shift probably null
R5301:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5367:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5446:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5484:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5506:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5561:Mroh2a UTSW 1 88232257 frame shift probably null
R5615:Mroh2a UTSW 1 88232257 frame shift probably null
R5825:Mroh2a UTSW 1 88230680 nonsense probably null
R5891:Mroh2a UTSW 1 88241615 missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5928:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R6004:Mroh2a UTSW 1 88248655 missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88230668 missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88232257 frame shift probably null
R6074:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R6091:Mroh2a UTSW 1 88232257 frame shift probably null
R6127:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6244:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6464:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88232257 frame shift probably null
R6575:Mroh2a UTSW 1 88232257 frame shift probably null
R6809:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R6819:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R6854:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R6860:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R7126:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
RF024:Mroh2a UTSW 1 88242485 missense probably damaging 1.00
V5622:Mroh2a UTSW 1 88227091 start gained probably benign
V8831:Mroh2a UTSW 1 88256167 frame shift probably null
X0027:Mroh2a UTSW 1 88248613 missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88232257 frame shift probably null
X0028:Mroh2a UTSW 1 88256166 frame shift probably null
X0033:Mroh2a UTSW 1 88256166 frame shift probably null
X0034:Mroh2a UTSW 1 88232257 frame shift probably null
X0034:Mroh2a UTSW 1 88256166 frame shift probably null
X0034:Mroh2a UTSW 1 88232292 missense probably damaging 1.00
X0039:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88256166 frame shift probably null
X0057:Mroh2a UTSW 1 88255655 missense probably benign 0.25
X0063:Mroh2a UTSW 1 88232257 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCTGTAGAGCCCTTTCTGG -3'
(R):5'- ATTCCTTCCTGTCAGGGACC -3'

Sequencing Primer
(F):5'- TGGGGCTGCTCTCTCTC -3'
(R):5'- ACCTTCCTGGACTTTGAAGATTG -3'
Posted On2016-01-20