Incidental Mutation 'R4190:Sp110'
ID368294
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene NameSp110 nuclear body protein
Synonyms5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R4190 (G1)
Quality Score25
Status Validated
Chromosome1
Chromosomal Location85576899-85598817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 85589118 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 219 (E219D)
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508]
PDB Structure
Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000093508
AA Change: E219D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034
AA Change: E219D

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186740
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85577329 missense probably benign
IGL00510:Sp110 APN 1 85577329 missense probably benign
IGL00516:Sp110 APN 1 85577329 missense probably benign
IGL00990:Sp110 APN 1 85586281 missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85577329 missense probably benign
FR4342:Sp110 UTSW 1 85587488 small insertion probably benign
FR4976:Sp110 UTSW 1 85587489 small insertion probably benign
IGL03147:Sp110 UTSW 1 85591567 frame shift probably null
PIT4131001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4131001:Sp110 UTSW 1 85586254 missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4142001:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0472:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R0551:Sp110 UTSW 1 85589100 splice site probably benign
R0638:Sp110 UTSW 1 85577329 missense probably benign
R0806:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0806:Sp110 UTSW 1 85586281 missense possibly damaging 0.51
R1074:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1079:Sp110 UTSW 1 85589104 splice site probably benign
R1228:Sp110 UTSW 1 85591760 missense probably benign 0.03
R1403:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1406:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1418:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1718:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1744:Sp110 UTSW 1 85594372 missense probably benign 0.26
R1747:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1806:Sp110 UTSW 1 85596110 critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85577329 missense probably benign
R2404:Sp110 UTSW 1 85577329 missense probably benign
R2964:Sp110 UTSW 1 85577329 missense probably benign
R3176:Sp110 UTSW 1 85577329 missense probably benign
R4398:Sp110 UTSW 1 85577329 missense probably benign
R4505:Sp110 UTSW 1 85589173 missense probably damaging 1.00
R4565:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4625:Sp110 UTSW 1 85577329 missense probably benign
R4922:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4986:Sp110 UTSW 1 85591760 missense probably benign 0.03
R5014:Sp110 UTSW 1 85577329 missense probably benign
R5080:Sp110 UTSW 1 85596055 nonsense probably null
R5087:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5254:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5335:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5353:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5383:Sp110 UTSW 1 85591569 frame shift probably null
R5387:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5389:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5398:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5443:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5729:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5752:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5754:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5799:Sp110 UTSW 1 85577329 missense probably benign
R6027:Sp110 UTSW 1 85577318 missense possibly damaging 0.83
R6171:Sp110 UTSW 1 85577329 missense probably benign
R6367:Sp110 UTSW 1 85594292 missense probably benign 0.00
R6771:Sp110 UTSW 1 85592279 intron probably null
R7097:Sp110 UTSW 1 85579685 missense possibly damaging 0.80
R7519:Sp110 UTSW 1 85579092 missense
R7520:Sp110 UTSW 1 85579092 missense
R7594:Sp110 UTSW 1 85579092 missense
R7596:Sp110 UTSW 1 85579092 missense
R7598:Sp110 UTSW 1 85579092 missense
R7600:Sp110 UTSW 1 85579092 missense
R7601:Sp110 UTSW 1 85579092 missense
R7602:Sp110 UTSW 1 85579092 missense
R7640:Sp110 UTSW 1 85579092 missense
R7641:Sp110 UTSW 1 85579092 missense
R7674:Sp110 UTSW 1 85579092 missense
R7691:Sp110 UTSW 1 85579092 missense
R7695:Sp110 UTSW 1 85579092 missense
R8072:Sp110 UTSW 1 85587486 small insertion probably benign
X0035:Sp110 UTSW 1 85586254 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTATCCCAAGCAAGGTTG -3'
(R):5'- GCCTTCCTTACTGGTTAGAATCA -3'

Sequencing Primer
(F):5'- GTTGCTAAGAGTTAAGTCAGCC -3'
(R):5'- GGTTAGAATCACTGTTCTCTTTACTG -3'
Posted On2016-01-21