Incidental Mutation 'R4190:Fam185a'
ID368295
Institutional Source Beutler Lab
Gene Symbol Fam185a
Ensembl Gene ENSMUSG00000047221
Gene Namefamily with sequence similarity 185, member A
Synonyms
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4190 (G1)
Quality Score52
Status Validated
Chromosome5
Chromosomal Location21424958-21482124 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 21425124 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030552] [ENSMUST00000056045] [ENSMUST00000115245]
Predicted Effect probably benign
Transcript: ENSMUST00000030552
SMART Domains Protein: ENSMUSP00000030552
Gene: ENSMUSG00000064280

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 120 130 N/A INTRINSIC
coiled coil region 194 320 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056045
SMART Domains Protein: ENSMUSP00000058333
Gene: ENSMUSG00000047221

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115245
SMART Domains Protein: ENSMUSP00000110900
Gene: ENSMUSG00000064280

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 120 130 N/A INTRINSIC
coiled coil region 194 320 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
coiled coil region 438 477 N/A INTRINSIC
coiled coil region 549 595 N/A INTRINSIC
coiled coil region 617 663 N/A INTRINSIC
coiled coil region 690 720 N/A INTRINSIC
coiled coil region 770 793 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153301
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Fam185a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Fam185a APN 5 21480342 missense probably damaging 1.00
IGL01980:Fam185a APN 5 21459173 missense probably damaging 1.00
IGL02096:Fam185a APN 5 21425343 missense probably damaging 1.00
IGL02264:Fam185a APN 5 21480394 missense possibly damaging 0.63
IGL02553:Fam185a APN 5 21455831 missense probably damaging 1.00
IGL02553:Fam185a APN 5 21429841 splice site probably benign
IGL03082:Fam185a APN 5 21455838 missense possibly damaging 0.49
famine UTSW 5 21425454 missense probably benign 0.00
R0389:Fam185a UTSW 5 21459285 missense probably damaging 0.99
R1872:Fam185a UTSW 5 21480330 critical splice acceptor site probably null
R1883:Fam185a UTSW 5 21425244 missense possibly damaging 0.85
R3775:Fam185a UTSW 5 21455806 missense probably damaging 1.00
R4192:Fam185a UTSW 5 21425124 unclassified probably benign
R4194:Fam185a UTSW 5 21425454 missense probably benign 0.00
R4704:Fam185a UTSW 5 21480473 utr 3 prime probably benign
R4724:Fam185a UTSW 5 21455787 missense probably damaging 1.00
R4837:Fam185a UTSW 5 21480377 missense probably benign 0.00
R6225:Fam185a UTSW 5 21425556 missense probably damaging 0.99
R6438:Fam185a UTSW 5 21458972 unclassified probably null
R6475:Fam185a UTSW 5 21425283 missense probably benign 0.01
R7512:Fam185a UTSW 5 21447358 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTGACTTGTCCAGGTCAG -3'
(R):5'- ATACTTGACCTGCAGGCTGTC -3'

Sequencing Primer
(F):5'- CCAGGTCAGGGTTTCAACTAG -3'
(R):5'- TGCGCAAGGGGATCCAG -3'
Posted On2016-01-21