Incidental Mutation 'R4235:Olfr679'
ID368302
Institutional Source Beutler Lab
Gene Symbol Olfr679
Ensembl Gene ENSMUSG00000096029
Gene Nameolfactory receptor 679
SynonymsMOR40-2, GA_x6K02T2PBJ9-7714499-7715446
MMRRC Submission 041052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4235 (G1)
Quality Score55
Status Validated
Chromosome7
Chromosomal Location105081205-105090642 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105085787 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 24 (S24T)
Ref Sequence ENSEMBL: ENSMUSP00000149116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042676] [ENSMUST00000098158] [ENSMUST00000214328] [ENSMUST00000215704]
Predicted Effect probably benign
Transcript: ENSMUST00000042676
Predicted Effect possibly damaging
Transcript: ENSMUST00000098158
AA Change: S24T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095761
Gene: ENSMUSG00000096029
AA Change: S24T

DomainStartEndE-ValueType
Pfam:7tm_4 35 314 1.2e-73 PFAM
Pfam:7TM_GPCR_Srsx 39 311 6.2e-10 PFAM
Pfam:7tm_1 45 296 1.8e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214328
AA Change: S24T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214738
Predicted Effect possibly damaging
Transcript: ENSMUST00000215704
AA Change: S24T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.2692 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
5730596B20Rik G T 6: 52,178,961 probably benign Het
9530053A07Rik T A 7: 28,156,648 D1953E probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Bnc2 A G 4: 84,293,514 V231A probably damaging Het
Bod1l A G 5: 41,821,455 S839P probably damaging Het
Casp8 T A 1: 58,833,698 H264Q possibly damaging Het
Cc2d1b A T 4: 108,625,352 probably benign Het
Cpne6 A T 14: 55,513,600 probably benign Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dgkd T A 1: 87,931,982 L774* probably null Het
Fbxl2 T A 9: 113,989,163 N205I probably benign Het
Fkbp15 A T 4: 62,336,456 I269K probably benign Het
Gm13023 G C 4: 143,794,774 C320S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Has1 G T 17: 17,850,036 R208S possibly damaging Het
Hecw1 C G 13: 14,317,139 A423P probably benign Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Ifi208 T G 1: 173,682,911 S211A probably benign Het
Ighv6-3 T C 12: 114,391,874 E65G probably damaging Het
Igkv9-120 A T 6: 68,050,333 D77V probably benign Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm2a A G 19: 4,322,521 I932T probably damaging Het
Krt17 T C 11: 100,257,868 T279A possibly damaging Het
Lamp1 T C 8: 13,167,192 V67A possibly damaging Het
Limk1 T C 5: 134,670,478 I142V probably benign Het
Mamdc2 T C 19: 23,374,017 N182D possibly damaging Het
Mcpt1 G A 14: 56,018,560 probably null Het
Med12l T G 3: 59,257,223 probably null Het
Mfsd10 G T 5: 34,635,625 T44N probably damaging Het
Mrps27 T C 13: 99,405,041 S218P probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Neil2 A C 14: 63,191,841 M1R probably null Het
Nelfcd T C 2: 174,427,048 F587L probably damaging Het
Nfil3 T C 13: 52,968,799 D23G probably benign Het
Nit2 T C 16: 57,157,160 K169R probably benign Het
Nxt1 T C 2: 148,675,347 S3P probably benign Het
Ogt A G X: 101,667,525 N434D probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rsl1 T C 13: 67,177,162 probably null Het
Sobp G A 10: 43,022,900 H230Y probably damaging Het
Sptan1 A G 2: 30,026,588 E2096G probably damaging Het
Tie1 G T 4: 118,478,405 S797* probably null Het
Tmem266 T C 9: 55,418,107 I186T probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tnfaip6 T C 2: 52,050,864 F139S probably damaging Het
Tnrc6a T C 7: 123,171,680 S898P probably benign Het
Trim24 A G 6: 37,964,740 D911G probably damaging Het
Tyw5 T C 1: 57,388,488 probably benign Het
Ubr3 C T 2: 70,016,385 Q1651* probably null Het
Unc13c T A 9: 73,530,952 I1943F possibly damaging Het
Usp47 T A 7: 112,110,048 S1334T probably damaging Het
Vmn1r215 T A 13: 23,075,931 V47E probably benign Het
Vmn1r224 T A 17: 20,419,362 M67K possibly damaging Het
Wdfy3 T A 5: 101,922,634 probably null Het
Zfc3h1 T C 10: 115,418,799 Y1433H probably benign Het
Other mutations in Olfr679
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02247:Olfr679 APN 7 105086323 nonsense probably null
IGL02505:Olfr679 APN 7 105086333 missense probably benign
IGL03160:Olfr679 APN 7 105086313 missense probably damaging 1.00
R0079:Olfr679 UTSW 7 105085928 missense probably damaging 1.00
R2126:Olfr679 UTSW 7 105086615 missense probably damaging 1.00
R2185:Olfr679 UTSW 7 105086302 missense possibly damaging 0.79
R3122:Olfr679 UTSW 7 105086178 missense probably benign 0.00
R3828:Olfr679 UTSW 7 105086297 missense probably benign 0.00
R4360:Olfr679 UTSW 7 105086253 missense probably damaging 0.99
R4485:Olfr679 UTSW 7 105086601 missense probably damaging 1.00
R4790:Olfr679 UTSW 7 105086637 unclassified probably benign
R5542:Olfr679 UTSW 7 105086358 missense probably damaging 1.00
R5599:Olfr679 UTSW 7 105086550 splice site probably null
R5723:Olfr679 UTSW 7 105091102 missense probably damaging 0.99
R5770:Olfr679 UTSW 7 105090895 missense probably damaging 0.99
R5871:Olfr679 UTSW 7 105086304 missense possibly damaging 0.65
R7231:Olfr679 UTSW 7 105085787 missense possibly damaging 0.94
R7593:Olfr679 UTSW 7 105086165 missense probably benign
R7881:Olfr679 UTSW 7 105086573 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTTGACTTGGATAACCTGCTAC -3'
(R):5'- CTAGTACCTTGGGGATGACAGTG -3'

Sequencing Primer
(F):5'- GACTTGGATAACCTGCTACAATTG -3'
(R):5'- CAGTGAGGCAGAGTATGATGTCC -3'
Posted On2016-01-22