Incidental Mutation 'R4158:Zfp981'
Institutional Source Beutler Lab
Gene Symbol Zfp981
Ensembl Gene ENSMUSG00000056300
Gene Namezinc finger protein 981
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4158 (G1)
Quality Score44
Status Validated
Chromosomal Location146502027-146539395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 146537882 bp
Amino Acid Change Histidine to Glutamine at position 421 (H421Q)
Ref Sequence ENSEMBL: ENSMUSP00000136739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105735] [ENSMUST00000140089] [ENSMUST00000179175]
Predicted Effect probably benign
Transcript: ENSMUST00000105735
AA Change: H421Q

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101361
Gene: ENSMUSG00000056300
AA Change: H421Q

KRAB 13 73 2.34e-15 SMART
ZnF_C2H2 239 261 7.9e-4 SMART
ZnF_C2H2 267 289 8.6e-5 SMART
ZnF_C2H2 295 317 8.6e-5 SMART
ZnF_C2H2 323 345 1.36e-2 SMART
ZnF_C2H2 351 373 6.32e-3 SMART
ZnF_C2H2 379 401 8.6e-5 SMART
ZnF_C2H2 407 429 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140089
SMART Domains Protein: ENSMUSP00000115886
Gene: ENSMUSG00000056300

KRAB 13 73 2.34e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145269
Predicted Effect probably benign
Transcript: ENSMUST00000179175
AA Change: H421Q

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000136739
Gene: ENSMUSG00000056300
AA Change: H421Q

KRAB 13 73 2.34e-15 SMART
ZnF_C2H2 239 261 7.9e-4 SMART
ZnF_C2H2 267 289 8.6e-5 SMART
ZnF_C2H2 295 317 8.6e-5 SMART
ZnF_C2H2 323 345 1.36e-2 SMART
ZnF_C2H2 351 373 6.32e-3 SMART
ZnF_C2H2 379 401 8.6e-5 SMART
ZnF_C2H2 407 429 3.11e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181199
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Other mutations in Zfp981
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02647:Zfp981 APN 4 146537252 nonsense probably null
R0003:Zfp981 UTSW 4 146537760 missense probably damaging 1.00
R1172:Zfp981 UTSW 4 146537764 missense probably benign
R2989:Zfp981 UTSW 4 146537890 missense probably benign 0.40
R4158:Zfp981 UTSW 4 146537623 missense probably benign
R4778:Zfp981 UTSW 4 146537655 missense probably benign
R5148:Zfp981 UTSW 4 146536900 missense possibly damaging 0.86
R5352:Zfp981 UTSW 4 146537005 missense probably benign 0.29
R6252:Zfp981 UTSW 4 146537513 missense probably benign 0.22
R6674:Zfp981 UTSW 4 146535493 missense probably damaging 0.98
R6765:Zfp981 UTSW 4 146537906 missense probably benign 0.34
R7288:Zfp981 UTSW 4 146537643 missense probably benign 0.32
R7816:Zfp981 UTSW 4 146537643 missense probably benign 0.32
R7835:Zfp981 UTSW 4 146537876 missense probably benign 0.01
R8020:Zfp981 UTSW 4 146537368 missense possibly damaging 0.91
Z1176:Zfp981 UTSW 4 146537090 missense probably damaging 0.96
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-01-25