Incidental Mutation 'R4222:Adgre4'
ID368313
Institutional Source Beutler Lab
Gene Symbol Adgre4
Ensembl Gene ENSMUSG00000032915
Gene Nameadhesion G protein-coupled receptor E4
SynonymsGpr127, EGF-TM7, FIRE, Emr4, D17Ertd479e
MMRRC Submission 041042-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4222 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location55749984-55853662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55785121 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 127 (Y127C)
Ref Sequence ENSEMBL: ENSMUSP00000025004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025004]
Predicted Effect probably damaging
Transcript: ENSMUST00000025004
AA Change: Y127C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025004
Gene: ENSMUSG00000032915
AA Change: Y127C

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:EGF_like 38 76 2e-10 BLAST
Pfam:EGF_CA 77 117 3.6e-9 PFAM
GPS 288 338 4.03e-12 SMART
Pfam:7tm_2 343 588 5.7e-57 PFAM
low complexity region 613 628 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 91% (49/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,718,749 S1115T probably benign Het
AF366264 T C 8: 13,838,061 E10G probably benign Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Alkal1 A G 1: 6,388,615 K76R probably damaging Het
Atm T C 9: 53,480,669 S1807G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
Cyp3a11 A T 5: 145,860,466 Y368N probably damaging Het
Gar1 A T 3: 129,830,806 probably benign Het
Gm5265 A T 1: 169,453,801 noncoding transcript Het
Gm7964 T G 7: 83,756,822 N281K probably damaging Het
Grin1 T C 2: 25,297,320 probably benign Het
Hapln4 T A 8: 70,086,960 W214R probably damaging Het
Hist1h1b A T 13: 21,779,977 probably benign Het
Irgq C A 7: 24,533,625 A297D possibly damaging Het
Kri1 T C 9: 21,281,063 E145G probably benign Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Mrpl22 T A 11: 58,171,867 probably benign Het
Myo7a T A 7: 98,073,229 Q1163L possibly damaging Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Nrxn3 G T 12: 89,532,992 G718* probably null Het
Olfm3 C T 3: 115,090,171 Q41* probably null Het
Olfr52 G T 2: 86,181,997 T38K probably damaging Het
Olfr617 A G 7: 103,584,759 T246A probably damaging Het
Parm1 G A 5: 91,593,867 M31I probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Pkn2 A T 3: 142,793,866 L950* probably null Het
Plec C T 15: 76,177,319 R2671H probably damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Ptk7 A T 17: 46,574,463 M679K probably benign Het
Ptx3 C T 3: 66,224,706 T216I probably damaging Het
Rrp8 T C 7: 105,734,022 I346V possibly damaging Het
Rsrc1 A G 3: 66,994,567 K17E unknown Het
Ryr2 T A 13: 11,737,873 E1854V possibly damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Spag5 G A 11: 78,304,511 V215I probably damaging Het
Ston1 A G 17: 88,636,771 Y535C probably damaging Het
Tbc1d14 A T 5: 36,493,108 S395T probably benign Het
Tlr11 C T 14: 50,361,849 P431S probably damaging Het
Trerf1 G T 17: 47,314,801 noncoding transcript Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Ttc26 A G 6: 38,395,075 Y200C probably damaging Het
Vmn1r49 A G 6: 90,072,246 F258S probably benign Het
Vmn1r-ps103 C A 13: 22,442,028 noncoding transcript Het
Vmn2r14 A G 5: 109,216,283 M589T probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Zbtb5 A G 4: 44,993,855 probably null Het
Zfp35 T G 18: 24,003,189 F197V possibly damaging Het
Other mutations in Adgre4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adgre4 APN 17 55791915 splice site probably benign
IGL00228:Adgre4 APN 17 55802135 missense probably damaging 1.00
IGL00572:Adgre4 APN 17 55820648 missense probably benign 0.00
IGL01404:Adgre4 APN 17 55797639 missense possibly damaging 0.63
IGL01420:Adgre4 APN 17 55799785 splice site probably benign
IGL01501:Adgre4 APN 17 55802002 splice site probably benign
IGL01510:Adgre4 APN 17 55818760 critical splice donor site probably null
IGL01554:Adgre4 APN 17 55817090 missense probably damaging 1.00
IGL01607:Adgre4 APN 17 55794748 splice site probably benign
IGL01767:Adgre4 APN 17 55797740 missense probably benign 0.19
IGL02253:Adgre4 APN 17 55760573 missense probably benign 0.01
IGL02358:Adgre4 APN 17 55843209 missense probably benign 0.15
IGL02466:Adgre4 APN 17 55814188 missense probably benign 0.42
IGL03057:Adgre4 APN 17 55799602 splice site probably benign
R0070:Adgre4 UTSW 17 55802154 missense probably damaging 0.98
R0070:Adgre4 UTSW 17 55802154 missense probably damaging 0.98
R0111:Adgre4 UTSW 17 55817073 missense possibly damaging 0.92
R0311:Adgre4 UTSW 17 55802010 missense probably benign 0.36
R0366:Adgre4 UTSW 17 55792001 nonsense probably null
R0415:Adgre4 UTSW 17 55852288 missense probably benign 0.03
R0465:Adgre4 UTSW 17 55785137 splice site probably benign
R0619:Adgre4 UTSW 17 55820679 missense possibly damaging 0.52
R0685:Adgre4 UTSW 17 55792035 missense probably benign 0.05
R0724:Adgre4 UTSW 17 55852281 missense probably benign 0.00
R0835:Adgre4 UTSW 17 55799637 missense probably damaging 1.00
R1330:Adgre4 UTSW 17 55778814 missense probably benign 0.36
R1452:Adgre4 UTSW 17 55784996 missense probably benign 0.35
R1960:Adgre4 UTSW 17 55791497 missense probably benign
R1961:Adgre4 UTSW 17 55791497 missense probably benign
R2046:Adgre4 UTSW 17 55778847 missense possibly damaging 0.82
R2421:Adgre4 UTSW 17 55778872 missense probably benign 0.10
R2570:Adgre4 UTSW 17 55778878 missense possibly damaging 0.54
R3162:Adgre4 UTSW 17 55802218 splice site probably benign
R4526:Adgre4 UTSW 17 55785016 nonsense probably null
R4631:Adgre4 UTSW 17 55814305 missense probably null 1.00
R4689:Adgre4 UTSW 17 55802096 missense probably damaging 1.00
R4701:Adgre4 UTSW 17 55784971 missense probably damaging 1.00
R4792:Adgre4 UTSW 17 55791491 missense probably benign 0.00
R5205:Adgre4 UTSW 17 55794727 nonsense probably null
R5210:Adgre4 UTSW 17 55785029 missense probably damaging 0.97
R5358:Adgre4 UTSW 17 55818758 missense probably benign 0.00
R5873:Adgre4 UTSW 17 55852282 missense probably benign 0.13
R6025:Adgre4 UTSW 17 55792013 missense probably benign 0.00
R6257:Adgre4 UTSW 17 55802133 missense possibly damaging 0.87
R6426:Adgre4 UTSW 17 55802196 missense probably benign 0.18
R6440:Adgre4 UTSW 17 55794744 critical splice donor site probably null
R6484:Adgre4 UTSW 17 55802036 missense possibly damaging 0.52
R6680:Adgre4 UTSW 17 55791959 missense probably benign 0.09
R7086:Adgre4 UTSW 17 55820649 missense probably benign 0.00
R7442:Adgre4 UTSW 17 55852340 missense probably benign 0.04
R7467:Adgre4 UTSW 17 55791952 missense probably benign 0.00
R7875:Adgre4 UTSW 17 55792016 missense probably benign 0.00
R7958:Adgre4 UTSW 17 55792016 missense probably benign 0.00
R8007:Adgre4 UTSW 17 55814233 missense probably damaging 0.99
S24628:Adgre4 UTSW 17 55852288 missense probably benign 0.03
X0010:Adgre4 UTSW 17 55814308 missense probably damaging 1.00
Z1177:Adgre4 UTSW 17 55814152 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAGTCTGGGAGTAGAGGCTTTATAG -3'
(R):5'- GGAAGCAGTTATTTGGTCCTAGAG -3'

Sequencing Primer
(F):5'- GGGAGTAGAGGCTTTATAGTTAAAAG -3'
(R):5'- GGTCCTAGAGATTAAATGTGATTGC -3'
Posted On2016-01-25