Incidental Mutation 'R4302:Sgsm3'
ID368317
Institutional Source Beutler Lab
Gene Symbol Sgsm3
Ensembl Gene ENSMUSG00000042303
Gene Namesmall G protein signaling modulator 3
SynonymsCIP85, Rutbc3, 1810012I01Rik
MMRRC Submission 041089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R4302 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location80977765-81012290 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 81010301 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109579] [ENSMUST00000131235] [ENSMUST00000134469] [ENSMUST00000137255] [ENSMUST00000139517] [ENSMUST00000143147] [ENSMUST00000149582] [ENSMUST00000228971] [ENSMUST00000229727]
Predicted Effect probably benign
Transcript: ENSMUST00000109579
SMART Domains Protein: ENSMUSP00000105207
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 15 40 2.17e-7 SMART
RPEL 59 84 1.36e-8 SMART
RPEL 103 128 1.03e-8 SMART
low complexity region 146 159 N/A INTRINSIC
low complexity region 209 228 N/A INTRINSIC
low complexity region 259 272 N/A INTRINSIC
low complexity region 298 320 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
SAP 385 419 4.98e-10 SMART
low complexity region 424 433 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
coiled coil region 558 600 N/A INTRINSIC
low complexity region 670 679 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124845
Predicted Effect probably benign
Transcript: ENSMUST00000131235
SMART Domains Protein: ENSMUSP00000120116
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 187 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 280 N/A INTRINSIC
SAP 300 334 4.98e-10 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
coiled coil region 473 515 N/A INTRINSIC
low complexity region 585 594 N/A INTRINSIC
low complexity region 629 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132039
Predicted Effect probably benign
Transcript: ENSMUST00000134469
SMART Domains Protein: ENSMUSP00000119530
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134559
Predicted Effect probably benign
Transcript: ENSMUST00000137255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138550
Predicted Effect probably benign
Transcript: ENSMUST00000139517
SMART Domains Protein: ENSMUSP00000122543
Gene: ENSMUSG00000042303

DomainStartEndE-ValueType
TBC 111 328 3.6e-62 SMART
low complexity region 381 391 N/A INTRINSIC
SH3 483 538 6.34e-19 SMART
RUN 654 716 1.29e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149345
Predicted Effect probably benign
Transcript: ENSMUST00000149582
SMART Domains Protein: ENSMUSP00000117745
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154904
SMART Domains Protein: ENSMUSP00000118050
Gene: ENSMUSG00000042303

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
SH3 114 169 6.34e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156783
Predicted Effect probably benign
Transcript: ENSMUST00000228971
Predicted Effect probably benign
Transcript: ENSMUST00000229727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230118
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,746,630 Y1445C probably damaging Het
Arhgef12 G A 9: 43,018,349 Q217* probably null Het
Bcas1 A G 2: 170,418,627 V44A probably benign Het
Clic4 A G 4: 135,226,039 V98A probably benign Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Creb3l1 T C 2: 91,993,319 I183V probably damaging Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Dync2h1 A T 9: 7,077,880 S2941T probably benign Het
Gm973 A G 1: 59,551,240 Y302C possibly damaging Het
Hcfc1 A G X: 73,949,366 S1398P probably benign Het
Igsf10 T C 3: 59,318,750 I2501V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mgam A G 6: 40,763,085 D1664G probably benign Het
Mill2 A T 7: 18,856,531 T179S probably damaging Het
Ncf4 T C 15: 78,260,762 probably benign Het
Nol12 T C 15: 78,940,141 S154P probably damaging Het
Nupl1 A G 14: 60,247,426 S50P probably benign Het
Olfr106-ps T A 17: 37,395,486 N315K probably benign Het
Olfr736 T C 14: 50,393,446 I230T probably benign Het
Olfr849 A G 9: 19,440,999 T29A probably benign Het
Pdss1 T C 2: 22,915,505 I265T probably damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rhpn2 A G 7: 35,390,845 T631A probably benign Het
Rps11 T C 7: 45,122,944 M80V probably benign Het
Rrm1 T C 7: 102,447,824 Y104H probably benign Het
Slc9c1 A T 16: 45,544,791 L162F probably benign Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Stk24 A G 14: 121,292,082 L386S probably benign Het
Tfcp2 G T 15: 100,514,849 N307K possibly damaging Het
Trbv21 T A 6: 41,202,768 V6D probably benign Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vmn2r38 A G 7: 9,097,563 probably null Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T A 16: 21,495,914 L158Q probably damaging Het
Wdr66 T C 5: 123,293,810 I549T probably benign Het
Other mutations in Sgsm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Sgsm3 APN 15 81010852 unclassified probably benign
IGL03370:Sgsm3 APN 15 81011654 critical splice acceptor site probably null
R0109:Sgsm3 UTSW 15 81009466 missense probably damaging 0.99
R0267:Sgsm3 UTSW 15 81006602 missense probably damaging 0.96
R0382:Sgsm3 UTSW 15 81008314 nonsense probably null
R0441:Sgsm3 UTSW 15 81009770 missense possibly damaging 0.87
R0631:Sgsm3 UTSW 15 81011736 makesense probably null
R0905:Sgsm3 UTSW 15 81011345 missense probably damaging 1.00
R1364:Sgsm3 UTSW 15 81007942 missense probably damaging 0.98
R1515:Sgsm3 UTSW 15 81010256 missense probably benign 0.08
R2226:Sgsm3 UTSW 15 81003868 missense probably damaging 0.96
R2227:Sgsm3 UTSW 15 81003868 missense probably damaging 0.96
R2414:Sgsm3 UTSW 15 81006745 missense probably benign 0.10
R2508:Sgsm3 UTSW 15 81003872 critical splice donor site probably null
R4240:Sgsm3 UTSW 15 81011782 unclassified probably benign
R4899:Sgsm3 UTSW 15 81006779 missense probably benign 0.13
R5234:Sgsm3 UTSW 15 81007944 missense probably damaging 1.00
R5288:Sgsm3 UTSW 15 81007999 missense probably benign 0.00
R5385:Sgsm3 UTSW 15 81007999 missense probably benign 0.00
R5386:Sgsm3 UTSW 15 81007999 missense probably benign 0.00
R5682:Sgsm3 UTSW 15 81011460 critical splice acceptor site probably null
R6052:Sgsm3 UTSW 15 81009263 missense probably benign
R6349:Sgsm3 UTSW 15 81008346 missense probably benign 0.00
R6453:Sgsm3 UTSW 15 81011314 missense probably damaging 0.96
R6486:Sgsm3 UTSW 15 81011345 missense probably damaging 1.00
R6591:Sgsm3 UTSW 15 81008862 missense possibly damaging 0.94
R6642:Sgsm3 UTSW 15 81009700 missense probably damaging 0.99
R6691:Sgsm3 UTSW 15 81008862 missense possibly damaging 0.94
R6897:Sgsm3 UTSW 15 81008894 missense probably benign 0.00
R7038:Sgsm3 UTSW 15 81008375 missense possibly damaging 0.86
R7390:Sgsm3 UTSW 15 81008820 missense possibly damaging 0.77
R7572:Sgsm3 UTSW 15 81007466 missense possibly damaging 0.78
R7730:Sgsm3 UTSW 15 81008726 missense probably damaging 1.00
R7851:Sgsm3 UTSW 15 81010753 missense probably damaging 1.00
R7934:Sgsm3 UTSW 15 81010753 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTCCTGCTTGAAGGTTC -3'
(R):5'- AGGATGGCTTCTTCAATCCG -3'

Sequencing Primer
(F):5'- CTGGGTGATTTGGGAGCCC -3'
(R):5'- CTTCAATCCGTGTTCAAACAGG -3'
Posted On2016-01-25