Incidental Mutation 'R4165:Sobp'
ID368319
Institutional Source Beutler Lab
Gene Symbol Sobp
Ensembl Gene ENSMUSG00000038248
Gene Namesine oculis binding protein
Synonyms2900009C16Rik, jc, 5330439J01Rik, Jxc1
MMRRC Submission 041007-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.675) question?
Stock #R4165 (G1)
Quality Score49
Status Validated
Chromosome10
Chromosomal Location43002500-43174530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43021648 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 647 (G647D)
Ref Sequence ENSEMBL: ENSMUSP00000040072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040275]
Predicted Effect probably damaging
Transcript: ENSMUST00000040275
AA Change: G647D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040072
Gene: ENSMUSG00000038248
AA Change: G647D

DomainStartEndE-ValueType
low complexity region 125 139 N/A INTRINSIC
internal_repeat_1 149 201 2.34e-5 PROSPERO
Pfam:SOBP 224 543 1.5e-88 PFAM
low complexity region 565 583 N/A INTRINSIC
low complexity region 590 603 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
low complexity region 695 714 N/A INTRINSIC
low complexity region 725 747 N/A INTRINSIC
Meta Mutation Damage Score 0.3309 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear zinc finger protein that is involved in development of the cochlea. Defects in this gene have also been linked to intellectual disability. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant mice exhibit open-field hyperactivity and circling behavior from weaning. Their hearing thresholds are elevated at all frequencies; the hearing impairment does not progress over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Adamts8 G T 9: 30,951,388 E296D probably benign Het
Alg11 T C 8: 22,065,557 V278A probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Armc4 A T 18: 7,217,008 I668K probably damaging Het
Avil C T 10: 127,006,627 Q92* probably null Het
CK137956 A T 4: 127,970,729 S36T possibly damaging Het
Epb41l3 T C 17: 69,207,888 S7P probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fsd2 T C 7: 81,545,860 T434A probably damaging Het
Gm5174 A G 10: 86,656,933 noncoding transcript Het
Gm8989 T A 7: 106,330,688 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Igkv15-103 G T 6: 68,437,840 G88* probably null Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Larp7 A G 3: 127,536,962 Y569H probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Nr1d2 T C 14: 18,215,446 I189V probably benign Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prap1 T A 7: 140,096,178 V35E probably benign Het
Prdm1 T A 10: 44,441,576 Y417F probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rps3 T C 7: 99,483,609 I5V probably benign Het
Sema3a A T 5: 13,473,397 probably null Het
Serpina3g A T 12: 104,240,287 T116S probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc22a28 A G 19: 8,063,408 S493P possibly damaging Het
Snapc1 G T 12: 73,982,580 probably null Het
Tomm22 C A 15: 79,671,005 probably benign Het
Trappc11 T C 8: 47,524,968 probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Vmn2r16 T C 5: 109,330,561 F61L possibly damaging Het
Zfp709 C T 8: 71,890,805 Q693* probably null Het
Other mutations in Sobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Sobp APN 10 43022878 missense probably damaging 1.00
IGL02112:Sobp APN 10 43021877 missense probably benign 0.07
R0071:Sobp UTSW 10 43157997 missense probably damaging 1.00
R0071:Sobp UTSW 10 43157997 missense probably damaging 1.00
R0602:Sobp UTSW 10 43022389 missense probably damaging 1.00
R0792:Sobp UTSW 10 43022693 missense probably damaging 0.99
R0847:Sobp UTSW 10 43022419 missense probably damaging 1.00
R0948:Sobp UTSW 10 43022209 missense probably damaging 1.00
R1298:Sobp UTSW 10 43022335 missense probably damaging 1.00
R1484:Sobp UTSW 10 43160831 missense probably damaging 1.00
R1486:Sobp UTSW 10 43022522 missense probably benign 0.42
R1543:Sobp UTSW 10 43021724 missense probably damaging 0.97
R1571:Sobp UTSW 10 43157946 missense possibly damaging 0.93
R1807:Sobp UTSW 10 43160826 missense possibly damaging 0.79
R2198:Sobp UTSW 10 43022524 missense possibly damaging 0.81
R2316:Sobp UTSW 10 43158038 missense possibly damaging 0.75
R4235:Sobp UTSW 10 43022900 missense probably damaging 1.00
R4378:Sobp UTSW 10 43021304 missense probably damaging 0.97
R4587:Sobp UTSW 10 43158024 missense probably damaging 1.00
R5108:Sobp UTSW 10 43160819 missense probably damaging 1.00
R6165:Sobp UTSW 10 43022603 missense probably damaging 1.00
R7069:Sobp UTSW 10 43021440 missense probably benign 0.37
R7346:Sobp UTSW 10 43022835 missense probably damaging 1.00
R7419:Sobp UTSW 10 43021808 missense probably benign 0.00
R7423:Sobp UTSW 10 43022568 nonsense probably null
R7475:Sobp UTSW 10 43021834 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCGCAGTTGTTCTCCTTGAC -3'
(R):5'- AAGCAGGGCTCTTCCAAGTC -3'

Sequencing Primer
(F):5'- CCTCGGACGACAGTAGCTTTTTG -3'
(R):5'- GCTCTTCCAAGTCAGCCGAC -3'
Posted On2016-01-25