Incidental Mutation 'R4165:Snapc1'
ID368321
Institutional Source Beutler Lab
Gene Symbol Snapc1
Ensembl Gene ENSMUSG00000021113
Gene Namesmall nuclear RNA activating complex, polypeptide 1
Synonyms2700033G17Rik
MMRRC Submission 041007-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4165 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location73964481-73988966 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 73982580 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000021532] [ENSMUST00000220882] [ENSMUST00000221556]
Predicted Effect probably null
Transcript: ENSMUST00000021532
SMART Domains Protein: ENSMUSP00000021532
Gene: ENSMUSG00000021113

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:SNAPc_SNAP43 26 210 4.5e-65 PFAM
low complexity region 261 273 N/A INTRINSIC
low complexity region 307 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220882
Predicted Effect probably null
Transcript: ENSMUST00000220909
Predicted Effect probably benign
Transcript: ENSMUST00000221556
Meta Mutation Damage Score 0.9589 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Adamts8 G T 9: 30,951,388 E296D probably benign Het
Alg11 T C 8: 22,065,557 V278A probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Armc4 A T 18: 7,217,008 I668K probably damaging Het
Avil C T 10: 127,006,627 Q92* probably null Het
CK137956 A T 4: 127,970,729 S36T possibly damaging Het
Epb41l3 T C 17: 69,207,888 S7P probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fsd2 T C 7: 81,545,860 T434A probably damaging Het
Gm5174 A G 10: 86,656,933 noncoding transcript Het
Gm8989 T A 7: 106,330,688 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Igkv15-103 G T 6: 68,437,840 G88* probably null Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Larp7 A G 3: 127,536,962 Y569H probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Nr1d2 T C 14: 18,215,446 I189V probably benign Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prap1 T A 7: 140,096,178 V35E probably benign Het
Prdm1 T A 10: 44,441,576 Y417F probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rps3 T C 7: 99,483,609 I5V probably benign Het
Sema3a A T 5: 13,473,397 probably null Het
Serpina3g A T 12: 104,240,287 T116S probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc22a28 A G 19: 8,063,408 S493P possibly damaging Het
Sobp C T 10: 43,021,648 G647D probably damaging Het
Tomm22 C A 15: 79,671,005 probably benign Het
Trappc11 T C 8: 47,524,968 probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Vmn2r16 T C 5: 109,330,561 F61L possibly damaging Het
Zfp709 C T 8: 71,890,805 Q693* probably null Het
Other mutations in Snapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Snapc1 APN 12 73968374 splice site probably null
IGL00529:Snapc1 APN 12 73964655 missense probably benign 0.00
IGL00676:Snapc1 APN 12 73971913 missense probably damaging 1.00
IGL01373:Snapc1 APN 12 73964680 missense probably benign 0.00
IGL02060:Snapc1 APN 12 73968036 missense probably damaging 1.00
IGL02309:Snapc1 APN 12 73968027 missense probably damaging 1.00
IGL02653:Snapc1 APN 12 73982487 missense probably benign 0.00
IGL02686:Snapc1 APN 12 73964596 intron probably benign
IGL03160:Snapc1 APN 12 73970204 missense probably damaging 1.00
PIT4362001:Snapc1 UTSW 12 73982495 missense probably damaging 0.98
R0056:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0057:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0057:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0113:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0152:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0153:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0244:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0245:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0316:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0318:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0352:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0646:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0841:Snapc1 UTSW 12 73975006 splice site probably benign
R2188:Snapc1 UTSW 12 73970227 missense probably damaging 1.00
R2483:Snapc1 UTSW 12 73964643 missense probably benign 0.02
R4169:Snapc1 UTSW 12 73982491 missense probably benign 0.00
R4549:Snapc1 UTSW 12 73970279 missense probably damaging 0.97
R4550:Snapc1 UTSW 12 73970279 missense probably damaging 0.97
R4658:Snapc1 UTSW 12 73983868 missense possibly damaging 0.75
R6976:Snapc1 UTSW 12 73970200 missense probably damaging 1.00
R7432:Snapc1 UTSW 12 73968294 missense probably benign 0.01
R7488:Snapc1 UTSW 12 73982511 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- ATGTGGAGCCTTGGTAAGC -3'
(R):5'- ACATCCGGATACTGCATCAC -3'

Sequencing Primer
(F):5'- TGGAGCCTTGGTAAGCTAATTAG -3'
(R):5'- ATCACTGCTTGCAGGCTG -3'
Posted On2016-01-25