Incidental Mutation 'R4227:P3h2'
ID 368329
Institutional Source Beutler Lab
Gene Symbol P3h2
Ensembl Gene ENSMUSG00000038168
Gene Name prolyl 3-hydroxylase 2
Synonyms Leprel1
MMRRC Submission 041047-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4227 (G1)
Quality Score 61.1
Status Validated
Chromosome 16
Chromosomal Location 25959288-26105784 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 26105453 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 77 (D77E)
Ref Sequence ENSEMBL: ENSMUSP00000038056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039990]
AlphaFold Q8CG71
Predicted Effect probably benign
Transcript: ENSMUST00000039990
AA Change: D77E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038056
Gene: ENSMUSG00000038168
AA Change: D77E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 27 36 N/A INTRINSIC
Pfam:TPR_2 42 73 2.5e-5 PFAM
low complexity region 81 104 N/A INTRINSIC
low complexity region 114 123 N/A INTRINSIC
Pfam:TPR_2 206 237 1.2e-5 PFAM
low complexity region 253 266 N/A INTRINSIC
internal_repeat_1 304 366 4.75e-7 PROSPERO
P4Hc 457 665 1.45e-51 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of exon 2 exhibit embryonic lethality between E8.5 and E12.5 with maternal platelets aggregate around the ectoplacental cone. Exon 3 knockouts are viable but mice exhibit reduced hydroxylation of collagen chains, especially in the sclera, leading to eye tissue dysmorphology and progressive myopia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,284,776 T609A probably damaging Het
Agbl2 T G 2: 90,801,453 L385R probably damaging Het
Arfgef2 A T 2: 166,867,324 D1107V probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
B9d1 C G 11: 61,512,657 R160G probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ceacam12 G T 7: 18,071,753 M288I probably benign Het
Cfhr3 T A 1: 139,608,308 noncoding transcript Het
Copa A G 1: 172,118,115 probably benign Het
Cypt4 A G 9: 24,625,492 M93V probably benign Het
Fat3 G A 9: 16,377,693 T178I probably damaging Het
Gm15931 A G 7: 4,274,794 noncoding transcript Het
Gm9871 A G 6: 101,796,693 noncoding transcript Het
Gpsm1 T C 2: 26,339,626 probably benign Het
Grhl1 A G 12: 24,611,851 T510A probably benign Het
Kcnn3 A C 3: 89,521,175 H236P possibly damaging Het
Kif21b T A 1: 136,154,093 probably null Het
Lcn3 G T 2: 25,766,111 M59I probably benign Het
Mrps27 C G 13: 99,411,340 P253A probably damaging Het
Mug2 A T 6: 122,040,732 D476V probably benign Het
Naca A T 10: 128,041,661 probably benign Het
Naip5 A G 13: 100,212,768 S1351P probably damaging Het
Odf2 A G 2: 29,901,284 probably benign Het
Olfr1143 T A 2: 87,802,875 I162N probably damaging Het
Olfr1284 A G 2: 111,379,065 K22E probably benign Het
Olfr444 A G 6: 42,955,714 Y72C possibly damaging Het
Olfr598 A T 7: 103,328,819 H111L probably damaging Het
Pcbp2 A G 15: 102,478,631 M87V probably benign Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhh2 A G 17: 84,566,795 T503A probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Ptprb T C 10: 116,302,225 Y345H possibly damaging Het
Rasl11b T A 5: 74,198,191 I119N probably damaging Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Serpina10 A G 12: 103,628,415 Y182H probably damaging Het
Serpina1d A G 12: 103,767,481 V188A probably benign Het
Setd1a C A 7: 127,796,647 probably benign Het
Slc17a8 T C 10: 89,598,713 N184S probably damaging Het
Spen C T 4: 141,522,147 S110N unknown Het
Tas1r1 T C 4: 152,028,272 I775V probably damaging Het
Tktl2 A G 8: 66,513,699 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Try5 A G 6: 41,313,467 Y28H possibly damaging Het
Urad A T 5: 147,315,290 F117L probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn2r45 A T 7: 8,483,278 V337E probably damaging Het
Vmn2r6 A T 3: 64,537,948 F696L probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp131 T C 13: 119,766,746 D455G probably damaging Het
Other mutations in P3h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:P3h2 APN 16 25992798 missense probably damaging 1.00
IGL01012:P3h2 APN 16 25987248 missense probably damaging 0.98
IGL02393:P3h2 APN 16 25992825 missense probably damaging 1.00
IGL02436:P3h2 APN 16 25997200 missense probably benign 0.01
PIT4445001:P3h2 UTSW 16 25984999 missense probably benign 0.01
R0319:P3h2 UTSW 16 25970931 missense possibly damaging 0.93
R0403:P3h2 UTSW 16 25969950 missense possibly damaging 0.63
R0962:P3h2 UTSW 16 25997248 missense probably benign
R1290:P3h2 UTSW 16 25987203 missense probably damaging 0.99
R1300:P3h2 UTSW 16 25997236 nonsense probably null
R1467:P3h2 UTSW 16 25965868 splice site probably benign
R1643:P3h2 UTSW 16 25972291 missense probably benign 0.00
R1645:P3h2 UTSW 16 25997232 missense probably damaging 1.00
R1761:P3h2 UTSW 16 25985050 missense probably damaging 0.96
R4273:P3h2 UTSW 16 26105221 missense probably benign 0.00
R4409:P3h2 UTSW 16 26105290 missense possibly damaging 0.88
R4410:P3h2 UTSW 16 26105290 missense possibly damaging 0.88
R4653:P3h2 UTSW 16 26105277 missense probably damaging 0.98
R4968:P3h2 UTSW 16 25992662 critical splice donor site probably null
R5190:P3h2 UTSW 16 25984949 missense possibly damaging 0.86
R6113:P3h2 UTSW 16 25981153 missense probably benign 0.01
R6225:P3h2 UTSW 16 25965743 missense probably damaging 0.97
R6838:P3h2 UTSW 16 26105284 missense possibly damaging 0.73
R6881:P3h2 UTSW 16 25992745 missense probably damaging 1.00
R7089:P3h2 UTSW 16 25965809 missense probably damaging 1.00
R7445:P3h2 UTSW 16 25985065 missense probably damaging 0.96
R7753:P3h2 UTSW 16 25970937 missense probably damaging 1.00
R8166:P3h2 UTSW 16 25992822 missense possibly damaging 0.89
R8363:P3h2 UTSW 16 25992718 missense probably damaging 0.98
R8442:P3h2 UTSW 16 25987205 missense probably benign 0.05
R8812:P3h2 UTSW 16 25982717 missense possibly damaging 0.67
R8965:P3h2 UTSW 16 25972384 missense probably benign 0.41
R9187:P3h2 UTSW 16 26105436 missense probably benign 0.27
R9193:P3h2 UTSW 16 26105241 missense probably benign 0.07
R9533:P3h2 UTSW 16 25970975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACTCTGCGTTGGAAGTC -3'
(R):5'- TGGAGGCGTCCCTTTAAGAG -3'

Sequencing Primer
(F):5'- TTGGAAGTCGCTGCGCAC -3'
(R):5'- TCCCTTTAAGAGCGGCCAG -3'
Posted On 2016-01-27