Incidental Mutation 'R4303:Rfxank'
ID368333
Institutional Source Beutler Lab
Gene Symbol Rfxank
Ensembl Gene ENSMUSG00000036120
Gene Nameregulatory factor X-associated ankyrin-containing protein
SynonymsTvl1
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70130794-70139154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70136212 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 89 (D89G)
Ref Sequence ENSEMBL: ENSMUSP00000148739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002418] [ENSMUST00000075724] [ENSMUST00000095273] [ENSMUST00000110139] [ENSMUST00000123760] [ENSMUST00000129668] [ENSMUST00000163756] [ENSMUST00000211898] [ENSMUST00000212320]
Predicted Effect probably benign
Transcript: ENSMUST00000002418
SMART Domains Protein: ENSMUSP00000002418
Gene: ENSMUSG00000002345

DomainStartEndE-ValueType
Pfam:NEP 1 119 1.7e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075724
AA Change: D89G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075140
Gene: ENSMUSG00000036120
AA Change: D89G

DomainStartEndE-ValueType
ANK 132 161 1.36e-2 SMART
ANK 165 194 5.16e-3 SMART
ANK 198 227 7.42e-4 SMART
ANK 231 260 2.35e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095273
SMART Domains Protein: ENSMUSP00000092907
Gene: ENSMUSG00000071078

DomainStartEndE-ValueType
SCOP:d1jhja_ 22 64 6e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110139
SMART Domains Protein: ENSMUSP00000105766
Gene: ENSMUSG00000002345

DomainStartEndE-ValueType
Pfam:NEP 1 107 2.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123760
SMART Domains Protein: ENSMUSP00000118102
Gene: ENSMUSG00000002345

DomainStartEndE-ValueType
Pfam:NEP 1 78 2.4e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123976
Predicted Effect probably benign
Transcript: ENSMUST00000129668
SMART Domains Protein: ENSMUSP00000137694
Gene: ENSMUSG00000002345

DomainStartEndE-ValueType
Pfam:NEP 1 78 2.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163756
SMART Domains Protein: ENSMUSP00000132314
Gene: ENSMUSG00000079033

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 320 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211970
Predicted Effect probably damaging
Transcript: ENSMUST00000212320
AA Change: D89G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212851
Meta Mutation Damage Score 0.3259 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. This protein contains ankyrin repeats involved in protein-protein interactions. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group B. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,401,057 S247P probably damaging Het
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehhadh C A 16: 21,762,852 K463N probably damaging Het
Ehmt2 G A 17: 34,908,748 R901Q possibly damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Ift80 A G 3: 68,894,174 I744T probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Krt36 A T 11: 100,103,413 D279E possibly damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Nuggc A G 14: 65,611,172 H174R possibly damaging Het
Olfr293 G A 7: 86,663,955 V98M probably benign Het
Olfr389 A T 11: 73,776,838 M163K possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Stard13 T C 5: 151,062,869 N392S possibly damaging Het
Tax1bp1 T C 6: 52,727,278 V81A possibly damaging Het
Trim29 G T 9: 43,311,122 V83L probably damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp579 A G 7: 4,993,073 probably benign Het
Zfp974 C A 7: 27,910,232 K689N possibly damaging Het
Other mutations in Rfxank
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1576:Rfxank UTSW 8 70134303 missense possibly damaging 0.95
R7033:Rfxank UTSW 8 70138170 missense probably benign
R7355:Rfxank UTSW 8 70135307 missense probably damaging 1.00
R7385:Rfxank UTSW 8 70134635 missense probably damaging 1.00
R7399:Rfxank UTSW 8 70135286 splice site probably null
R8218:Rfxank UTSW 8 70131435 splice site probably null
R8377:Rfxank UTSW 8 70135310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTAGCCACTGAGCCATAAG -3'
(R):5'- GTCTTCTTAAGCCTGGAGCC -3'

Sequencing Primer
(F):5'- GCACTTTACCCACTAAGCTACATTC -3'
(R):5'- TTCTTAAGCCTGGAGCCTGCAG -3'
Posted On2016-01-28