Incidental Mutation 'R4154:Plxnb2'
ID 368338
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Name plexin B2
Synonyms Debt, 1110007H23Rik
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock # R4154 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 89155549-89180788 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89159642 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1336 (F1336L)
Ref Sequence ENSEMBL: ENSMUSP00000104955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
AlphaFold B2RXS4
Predicted Effect probably damaging
Transcript: ENSMUST00000060808
AA Change: F1336L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: F1336L

signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109331
AA Change: F1336L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: F1336L

signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230393
Meta Mutation Damage Score 0.1923 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89156562 missense probably benign 0.04
R2418:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89157255 splice site probably benign
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89160928 missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89164209 splice site probably null
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89167032 missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89160759 missense possibly damaging 0.81
R5866:Plxnb2 UTSW 15 89167572 missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89167258 missense probably damaging 1.00
R6260:Plxnb2 UTSW 15 89165291 missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
R7354:Plxnb2 UTSW 15 89165725 missense possibly damaging 0.92
R7513:Plxnb2 UTSW 15 89158322 critical splice acceptor site probably null
R7522:Plxnb2 UTSW 15 89161774 missense probably benign 0.20
R7730:Plxnb2 UTSW 15 89162330 missense probably benign
R7766:Plxnb2 UTSW 15 89161271 missense probably benign 0.01
R7781:Plxnb2 UTSW 15 89157022 missense possibly damaging 0.89
R8126:Plxnb2 UTSW 15 89163303 missense probably benign
R8131:Plxnb2 UTSW 15 89158713 missense probably damaging 1.00
R8372:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R8736:Plxnb2 UTSW 15 89162058 missense probably damaging 1.00
R8772:Plxnb2 UTSW 15 89162746 missense probably damaging 1.00
R9022:Plxnb2 UTSW 15 89164268 missense possibly damaging 0.59
R9044:Plxnb2 UTSW 15 89160363 splice site probably benign
R9253:Plxnb2 UTSW 15 89167812 missense probably benign
R9398:Plxnb2 UTSW 15 89160919 missense probably benign 0.02
R9562:Plxnb2 UTSW 15 89165933 missense probably damaging 1.00
R9568:Plxnb2 UTSW 15 89160957 nonsense probably null
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Z1177:Plxnb2 UTSW 15 89159096 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2016-01-29