Incidental Mutation 'R4209:Zfyve1'
ID368340
Institutional Source Beutler Lab
Gene Symbol Zfyve1
Ensembl Gene ENSMUSG00000042628
Gene Namezinc finger, FYVE domain containing 1
Synonyms
MMRRC Submission 041038-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4209 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location83546558-83597222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83575135 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 162 (V162E)
Ref Sequence ENSEMBL: ENSMUSP00000152501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048319] [ENSMUST00000221919]
Predicted Effect probably damaging
Transcript: ENSMUST00000048319
AA Change: V162E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042224
Gene: ENSMUSG00000042628
AA Change: V162E

DomainStartEndE-ValueType
low complexity region 429 436 N/A INTRINSIC
FYVE 590 660 8.36e-13 SMART
FYVE 707 776 1.15e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221919
AA Change: V162E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.1704 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The FYVE domain mediates the recruitment of proteins involved in membrane trafficking and cell signaling to phosphatidylinositol 3-phosphate-containing membranes. This protein contains two zinc-binding FYVE domains in tandem and is reported to localize to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak G A 19: 9,002,600 G416D probably damaging Het
Ap3b2 C A 7: 81,477,136 A289S probably benign Het
Arhgap23 C A 11: 97,454,496 T657K probably damaging Het
Bcl9 A G 3: 97,209,953 L475P probably damaging Het
Bean1 T A 8: 104,213,934 M1K probably null Het
Cand1 T A 10: 119,211,558 I676F probably benign Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Cops4 T A 5: 100,547,486 probably benign Het
Dchs1 A T 7: 105,766,190 D626E probably damaging Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Fezf1 T C 6: 23,246,617 K323E probably damaging Het
Gm10272 T C 10: 77,706,831 V69A possibly damaging Het
Gm8298 A T 3: 59,877,156 Y350F probably damaging Het
Gtf2f1 A G 17: 57,011,003 V11A probably benign Het
Hnf4a T C 2: 163,568,889 S378P probably benign Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Irf8 T A 8: 120,753,469 Y149N probably damaging Het
Kel C T 6: 41,698,425 W297* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Mycl G T 4: 122,999,922 V172L possibly damaging Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Ppp2r2a A G 14: 67,028,879 L111S probably damaging Het
Prdm2 T C 4: 143,134,437 D761G probably damaging Het
Sec11a A T 7: 80,935,042 I49N probably damaging Het
Sesn3 T C 9: 14,306,209 I30T probably benign Het
Slc22a21 A G 11: 53,956,055 S331P probably benign Het
Slc38a3 T G 9: 107,655,348 S358R possibly damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Spns2 T C 11: 72,454,186 D492G probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tex16 T A X: 112,120,943 D1046E probably benign Het
Tmem120a T C 5: 135,735,705 N340S probably benign Het
Tnik A T 3: 28,359,065 probably benign Het
Trim36 A G 18: 46,196,124 L71P probably benign Het
Tube1 A G 10: 39,144,934 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Veph1 A T 3: 66,244,546 L154Q probably damaging Het
Vmn1r113 T C 7: 20,787,610 V109A probably benign Het
Vmn1r152 A T 7: 22,523,579 T205S possibly damaging Het
Wdsub1 G A 2: 59,876,805 P28S probably damaging Het
Ybx2 G T 11: 69,935,941 probably benign Het
Other mutations in Zfyve1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Zfyve1 APN 12 83574798 missense probably benign 0.09
IGL00475:Zfyve1 APN 12 83555711 critical splice acceptor site probably null
IGL01291:Zfyve1 APN 12 83555005 missense probably benign 0.04
IGL01380:Zfyve1 APN 12 83552507 missense probably damaging 1.00
IGL02037:Zfyve1 APN 12 83547920 missense probably damaging 1.00
IGL02184:Zfyve1 APN 12 83558693 missense probably benign 0.29
IGL02619:Zfyve1 APN 12 83550944 unclassified probably benign
IGL03031:Zfyve1 APN 12 83574821 missense probably damaging 0.99
IGL03105:Zfyve1 APN 12 83558639 missense probably damaging 1.00
sasso UTSW 12 83575056 missense probably damaging 1.00
ANU05:Zfyve1 UTSW 12 83555005 missense probably benign 0.04
R0123:Zfyve1 UTSW 12 83555073 splice site probably benign
R0225:Zfyve1 UTSW 12 83555073 splice site probably benign
R0468:Zfyve1 UTSW 12 83555274 splice site probably benign
R1218:Zfyve1 UTSW 12 83548051 missense possibly damaging 0.79
R1896:Zfyve1 UTSW 12 83555614 missense probably damaging 0.99
R2291:Zfyve1 UTSW 12 83547931 missense probably damaging 0.99
R4023:Zfyve1 UTSW 12 83594522 missense probably benign
R4026:Zfyve1 UTSW 12 83594522 missense probably benign
R4211:Zfyve1 UTSW 12 83575135 missense probably damaging 1.00
R4780:Zfyve1 UTSW 12 83558647 missense probably damaging 1.00
R4907:Zfyve1 UTSW 12 83574872 missense probably damaging 0.96
R4908:Zfyve1 UTSW 12 83551571 missense probably damaging 1.00
R4998:Zfyve1 UTSW 12 83548065 missense possibly damaging 0.69
R5076:Zfyve1 UTSW 12 83555647 missense probably damaging 1.00
R5303:Zfyve1 UTSW 12 83575056 missense probably damaging 1.00
R5628:Zfyve1 UTSW 12 83574889 missense probably benign 0.00
R5739:Zfyve1 UTSW 12 83575136 missense possibly damaging 0.61
R6007:Zfyve1 UTSW 12 83558704 missense probably damaging 1.00
R6355:Zfyve1 UTSW 12 83594641 missense probably benign 0.01
R6641:Zfyve1 UTSW 12 83594496 missense probably benign
R6735:Zfyve1 UTSW 12 83594844 missense possibly damaging 0.90
R7222:Zfyve1 UTSW 12 83555005 missense probably benign
R7278:Zfyve1 UTSW 12 83551540 missense probably damaging 1.00
R7464:Zfyve1 UTSW 12 83551487 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTTATGGACTGGGTCATAGG -3'
(R):5'- TCCTGGGAAGCAGTCATATTTC -3'

Sequencing Primer
(F):5'- GTCATAGGCTGCCCACACTC -3'
(R):5'- GCCCAGCAGTCATATTTCT -3'
Posted On2016-01-29