Incidental Mutation 'R4195:Gm6569'
ID368352
Institutional Source Beutler Lab
Gene Symbol Gm6569
Ensembl Gene ENSMUSG00000086361
Gene Namepredicted gene 6569
Synonyms
MMRRC Submission 041026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4195 (G1)
Quality Score188
Status Validated
Chromosome15
Chromosomal Location73834561-73839908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73836243 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 22 (P22L)
Ref Sequence ENSEMBL: ENSMUSP00000121081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071419] [ENSMUST00000154520]
Predicted Effect probably benign
Transcript: ENSMUST00000071419
SMART Domains Protein: ENSMUSP00000071366
Gene: ENSMUSG00000072487

DomainStartEndE-ValueType
low complexity region 173 184 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136698
Predicted Effect probably damaging
Transcript: ENSMUST00000154520
AA Change: P22L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121081
Gene: ENSMUSG00000086361
AA Change: P22L

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 104 119 N/A INTRINSIC
low complexity region 123 137 N/A INTRINSIC
low complexity region 140 166 N/A INTRINSIC
Meta Mutation Damage Score 0.1091 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Actg2 T G 6: 83,523,173 T39P probably damaging Het
Agap1 A G 1: 89,834,539 E531G probably damaging Het
Alox12b A G 11: 69,169,600 S661G probably benign Het
Apod T C 16: 31,297,574 M113V probably benign Het
Atl3 A G 19: 7,518,546 I171V possibly damaging Het
Atrn C A 2: 130,933,412 T145K probably damaging Het
Cacna1f A G X: 7,608,930 H57R probably damaging Het
Cldn9 T C 17: 23,683,174 E159G probably damaging Het
Cnnm4 C A 1: 36,499,508 H590Q probably benign Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Cse1l A G 2: 166,929,979 T387A probably damaging Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Fbll1 A G 11: 35,797,666 S257P possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
G3bp2 A G 5: 92,055,416 S349P probably damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gm281 C A 14: 13,829,772 V657L probably benign Het
Itih2 T C 2: 10,115,285 N314D probably damaging Het
Lman2l A C 1: 36,424,941 I266M probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Neb G T 2: 52,271,559 R2074S probably damaging Het
Neb A T 2: 52,290,835 H1226Q probably damaging Het
Nmi A C 2: 51,948,620 S301A probably benign Het
Olfr266 A T 3: 106,822,012 C182* probably null Het
Pclo A G 5: 14,677,563 probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Polr1e T C 4: 45,019,327 Y59H probably damaging Het
Slc30a4 G A 2: 122,685,270 T401M probably damaging Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Zfp990 A T 4: 145,536,977 probably null Het
Zzz3 A G 3: 152,428,465 T387A probably benign Het
Other mutations in Gm6569
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6225:Gm6569 UTSW 15 73839791 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCGGATTGATCTGAGTCAAG -3'
(R):5'- CAGAAGAAAGACTGGTGTCCTC -3'

Sequencing Primer
(F):5'- AAGGTACCTTCGGACTCTCATGAG -3'
(R):5'- GAAAGACTGGTGTCCTCCACTAC -3'
Posted On2016-01-29