Incidental Mutation 'R4195:Atl3'
ID 368353
Institutional Source Beutler Lab
Gene Symbol Atl3
Ensembl Gene ENSMUSG00000024759
Gene Name atlastin GTPase 3
Synonyms
MMRRC Submission 041026-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4195 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 7494040-7538608 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7518546 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 171 (I171V)
Ref Sequence ENSEMBL: ENSMUSP00000025668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025668] [ENSMUST00000170373]
AlphaFold Q91YH5
Predicted Effect possibly damaging
Transcript: ENSMUST00000025668
AA Change: I171V

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025668
Gene: ENSMUSG00000024759
AA Change: I171V

DomainStartEndE-ValueType
Pfam:GBP 36 310 7.2e-99 PFAM
Pfam:GBP_C 312 438 1.7e-9 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170373
AA Change: I166V

PolyPhen 2 Score 0.339 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132619
Gene: ENSMUSG00000024759
AA Change: I166V

DomainStartEndE-ValueType
Pfam:GBP 31 305 9.1e-98 PFAM
Pfam:GBP_C 307 433 7.4e-10 PFAM
transmembrane domain 439 461 N/A INTRINSIC
transmembrane domain 463 485 N/A INTRINSIC
Meta Mutation Damage Score 0.1458 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of dynamin-like, integral membrane GTPases. The encoded protein is required for the proper formation of the network of interconnected tubules of the endoplasmic reticulum. Mutations in this gene may be associated with hereditary sensory neuropathy type IF. Alternatively spliced transcript variants that encode distinct isoforms have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Actg2 T G 6: 83,523,173 T39P probably damaging Het
Agap1 A G 1: 89,834,539 E531G probably damaging Het
Alox12b A G 11: 69,169,600 S661G probably benign Het
Apod T C 16: 31,297,574 M113V probably benign Het
Atrn C A 2: 130,933,412 T145K probably damaging Het
Cacna1f A G X: 7,608,930 H57R probably damaging Het
Cldn9 T C 17: 23,683,174 E159G probably damaging Het
Cnnm4 C A 1: 36,499,508 H590Q probably benign Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Cse1l A G 2: 166,929,979 T387A probably damaging Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Fbll1 A G 11: 35,797,666 S257P possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
G3bp2 A G 5: 92,055,416 S349P probably damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gm281 C A 14: 13,829,772 V657L probably benign Het
Gm6569 C T 15: 73,836,243 P22L probably damaging Het
Itih2 T C 2: 10,115,285 N314D probably damaging Het
Lman2l A C 1: 36,424,941 I266M probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Neb G T 2: 52,271,559 R2074S probably damaging Het
Neb A T 2: 52,290,835 H1226Q probably damaging Het
Nmi A C 2: 51,948,620 S301A probably benign Het
Olfr266 A T 3: 106,822,012 C182* probably null Het
Pclo A G 5: 14,677,563 probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Polr1e T C 4: 45,019,327 Y59H probably damaging Het
Slc30a4 G A 2: 122,685,270 T401M probably damaging Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Zfp990 A T 4: 145,536,977 probably null Het
Zzz3 A G 3: 152,428,465 T387A probably benign Het
Other mutations in Atl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02667:Atl3 APN 19 7509416 missense possibly damaging 0.72
R0042:Atl3 UTSW 19 7529023 missense probably damaging 1.00
R0607:Atl3 UTSW 19 7529666 critical splice donor site probably null
R0975:Atl3 UTSW 19 7521135 nonsense probably null
R1582:Atl3 UTSW 19 7516899 missense probably damaging 1.00
R4249:Atl3 UTSW 19 7532338 missense probably benign 0.06
R4505:Atl3 UTSW 19 7520819 missense probably benign 0.00
R4836:Atl3 UTSW 19 7509545 nonsense probably null
R5649:Atl3 UTSW 19 7532227 missense possibly damaging 0.50
R5721:Atl3 UTSW 19 7529011 missense probably benign 0.00
R6459:Atl3 UTSW 19 7520798 missense probably benign 0.07
R6530:Atl3 UTSW 19 7522134 missense probably benign
R6543:Atl3 UTSW 19 7510098 missense probably damaging 1.00
R6550:Atl3 UTSW 19 7522138 missense probably benign
R7059:Atl3 UTSW 19 7533968 missense probably benign
R7059:Atl3 UTSW 19 7533969 missense probably benign 0.08
R7220:Atl3 UTSW 19 7529068 missense probably null 0.02
R7666:Atl3 UTSW 19 7510040 missense probably benign 0.19
R9143:Atl3 UTSW 19 7532043 missense probably benign 0.01
R9206:Atl3 UTSW 19 7510082 missense probably benign 0.09
R9208:Atl3 UTSW 19 7510082 missense probably benign 0.09
R9631:Atl3 UTSW 19 7532188 missense probably benign 0.00
R9709:Atl3 UTSW 19 7530556 missense probably benign 0.00
R9733:Atl3 UTSW 19 7532340 missense probably damaging 0.99
X0020:Atl3 UTSW 19 7530569 missense probably benign 0.00
Z1176:Atl3 UTSW 19 7510037 missense probably damaging 1.00
Z1177:Atl3 UTSW 19 7530553 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AACTTAAGCTCTTAGAGGCACA -3'
(R):5'- GCCACAGCCTTTTCATCCTA -3'

Sequencing Primer
(F):5'- CAGATAATACTGCTCTCTCTCTC -3'
(R):5'- ACAGCCTTTTCATCCTATCCCTC -3'
Posted On 2016-01-29