Mutagenetix > Incidental Mutations

Incidental Mutation 'R4195:Atl3'

368353

Institutional Source

Beutler Lab

Gene Symbol

Atl3

Ensembl Gene

ENSMUSG00000024759

Gene Name

atlastin GTPase 3

Synonyms

MMRRC Submission

041026-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4195 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7494040-7538608 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7518546 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 171 (I171V)

Ref Sequence

ENSEMBL: ENSMUSP00000025668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025668] [ENSMUST00000170373]

AlphaFold

Q91YH5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025668
AA Change: I171V

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000025668
Gene: ENSMUSG00000024759
AA Change: I171V

Domain	Start	End	E-Value	Type
Pfam:GBP	36	310	7.2e-99	PFAM
Pfam:GBP_C	312	438	1.7e-9	PFAM
transmembrane domain	444	466	N/A	INTRINSIC
transmembrane domain	468	490	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170373
AA Change: I166V

PolyPhen 2 Score 0.339 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000132619
Gene: ENSMUSG00000024759
AA Change: I166V

Domain	Start	End	E-Value	Type
Pfam:GBP	31	305	9.1e-98	PFAM
Pfam:GBP_C	307	433	7.4e-10	PFAM
transmembrane domain	439	461	N/A	INTRINSIC
transmembrane domain	463	485	N/A	INTRINSIC

Meta Mutation Damage Score

0.1458

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of dynamin-like, integral membrane GTPases. The encoded protein is required for the proper formation of the network of interconnected tubules of the endoplasmic reticulum. Mutations in this gene may be associated with hereditary sensory neuropathy type IF. Alternatively spliced transcript variants that encode distinct isoforms have been described. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acmsd	T	G	1: 127,749,194	L152R	probably damaging	Het
Actg2	T	G	6: 83,523,173	T39P	probably damaging	Het
Agap1	A	G	1: 89,834,539	E531G	probably damaging	Het
Alox12b	A	G	11: 69,169,600	S661G	probably benign	Het
Apod	T	C	16: 31,297,574	M113V	probably benign	Het
Atrn	C	A	2: 130,933,412	T145K	probably damaging	Het
Cacna1f	A	G	X: 7,608,930	H57R	probably damaging	Het
Cldn9	T	C	17: 23,683,174	E159G	probably damaging	Het
Cnnm4	C	A	1: 36,499,508	H590Q	probably benign	Het
Col19a1	G	A	1: 24,534,052	S213L	unknown	Het
Cse1l	A	G	2: 166,929,979	T387A	probably damaging	Het
Eif4enif1	T	C	11: 3,243,186	V675A	possibly damaging	Het
Fbll1	A	G	11: 35,797,666	S257P	possibly damaging	Het
Fbll1	T	A	11: 35,797,872	H188L	possibly damaging	Het
Frem2	A	G	3: 53,539,268	F2360L	possibly damaging	Het
G3bp2	A	G	5: 92,055,416	S349P	probably damaging	Het
Gm2396	A	G	9: 88,917,662		noncoding transcript	Het
Gm281	C	A	14: 13,829,772	V657L	probably benign	Het
Gm6569	C	T	15: 73,836,243	P22L	probably damaging	Het
Itih2	T	C	2: 10,115,285	N314D	probably damaging	Het
Lman2l	A	C	1: 36,424,941	I266M	probably damaging	Het
Mrps9	T	G	1: 42,901,094		probably benign	Het
Mtmr11	T	C	3: 96,167,891		probably benign	Het
Neb	G	T	2: 52,271,559	R2074S	probably damaging	Het
Neb	A	T	2: 52,290,835	H1226Q	probably damaging	Het
Nmi	A	C	2: 51,948,620	S301A	probably benign	Het
Olfr266	A	T	3: 106,822,012	C182*	probably null	Het
Pclo	A	G	5: 14,677,563		probably benign	Het
Pkd1l1	T	A	11: 8,909,929	I560F	probably damaging	Het
Polr1e	T	C	4: 45,019,327	Y59H	probably damaging	Het
Slc30a4	G	A	2: 122,685,270	T401M	probably damaging	Het
Tas1r3	T	C	4: 155,862,985	E81G	probably damaging	Het
Zfp990	A	T	4: 145,536,977		probably null	Het
Zzz3	A	G	3: 152,428,465	T387A	probably benign	Het

Other mutations in Atl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02667:Atl3	APN	19	7509416	missense	possibly damaging	0.72
R0042:Atl3	UTSW	19	7529023	missense	probably damaging	1.00
R0607:Atl3	UTSW	19	7529666	critical splice donor site	probably null
R0975:Atl3	UTSW	19	7521135	nonsense	probably null
R1582:Atl3	UTSW	19	7516899	missense	probably damaging	1.00
R4249:Atl3	UTSW	19	7532338	missense	probably benign	0.06
R4505:Atl3	UTSW	19	7520819	missense	probably benign	0.00
R4836:Atl3	UTSW	19	7509545	nonsense	probably null
R5649:Atl3	UTSW	19	7532227	missense	possibly damaging	0.50
R5721:Atl3	UTSW	19	7529011	missense	probably benign	0.00
R6459:Atl3	UTSW	19	7520798	missense	probably benign	0.07
R6530:Atl3	UTSW	19	7522134	missense	probably benign
R6543:Atl3	UTSW	19	7510098	missense	probably damaging	1.00
R6550:Atl3	UTSW	19	7522138	missense	probably benign
R7059:Atl3	UTSW	19	7533968	missense	probably benign
R7059:Atl3	UTSW	19	7533969	missense	probably benign	0.08
R7220:Atl3	UTSW	19	7529068	missense	probably null	0.02
R7666:Atl3	UTSW	19	7510040	missense	probably benign	0.19
X0020:Atl3	UTSW	19	7530569	missense	probably benign	0.00
Z1176:Atl3	UTSW	19	7510037	missense	probably damaging	1.00
Z1177:Atl3	UTSW	19	7530553	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- AACTTAAGCTCTTAGAGGCACA -3'
(R):5'- GCCACAGCCTTTTCATCCTA -3'

Sequencing Primer
(F):5'- CAGATAATACTGCTCTCTCTCTC -3'
(R):5'- ACAGCCTTTTCATCCTATCCCTC -3'

Posted On

2016-01-29