Incidental Mutation 'R4301:Mtmr12'
Institutional Source Beutler Lab
Gene Symbol Mtmr12
Ensembl Gene ENSMUSG00000039458
Gene Namemyotubularin related protein 12
SynonymsPip3ap, C730015A02Rik
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosomal Location12205028-12274496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12236020 bp
Amino Acid Change Phenylalanine to Isoleucine at position 122 (F122I)
Ref Sequence ENSEMBL: ENSMUSP00000133285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038172] [ENSMUST00000071993] [ENSMUST00000174160] [ENSMUST00000174418]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038172
AA Change: F122I

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041227
Gene: ENSMUSG00000039458
AA Change: F122I

low complexity region 3 12 N/A INTRINSIC
low complexity region 33 42 N/A INTRINSIC
Pfam:Myotub-related 182 501 7.6e-55 PFAM
Pfam:3-PAP 559 687 3.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071993
SMART Domains Protein: ENSMUSP00000071883
Gene: ENSMUSG00000039458

low complexity region 3 12 N/A INTRINSIC
Pfam:Myotub-related 17 193 7.8e-53 PFAM
Pfam:3-PAP 249 380 8.8e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173071
Predicted Effect possibly damaging
Transcript: ENSMUST00000174160
AA Change: F122I

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134293
Gene: ENSMUSG00000039458
AA Change: F122I

low complexity region 3 12 N/A INTRINSIC
low complexity region 33 42 N/A INTRINSIC
Pfam:Myotub-related 182 501 3.2e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174418
AA Change: F122I

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133285
Gene: ENSMUSG00000039458
AA Change: F122I

low complexity region 3 12 N/A INTRINSIC
low complexity region 33 42 N/A INTRINSIC
Meta Mutation Damage Score 0.1051 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositide 3-kinase-derived membrane-anchored phosphatidylinositides, such as phosphatidylinositol 3-phosphate (PtdIns(3)P), regulate diverse cellular processes. The protein encoded by this gene functions as an adaptor subunit in a complex with an active PtdIns(3)P 3-phosphatase. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Mtmr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01801:Mtmr12 APN 15 12269959 missense probably damaging 1.00
IGL02158:Mtmr12 APN 15 12237930 missense probably damaging 1.00
pius UTSW 15 12245011 missense probably damaging 1.00
R0281:Mtmr12 UTSW 15 12257706 nonsense probably null
R1739:Mtmr12 UTSW 15 12245019 missense probably benign 0.06
R1876:Mtmr12 UTSW 15 12257630 missense probably damaging 1.00
R2284:Mtmr12 UTSW 15 12245011 missense probably damaging 1.00
R4424:Mtmr12 UTSW 15 12230314 missense probably damaging 0.98
R4617:Mtmr12 UTSW 15 12270046 missense probably damaging 1.00
R5418:Mtmr12 UTSW 15 12269959 missense probably damaging 1.00
R6316:Mtmr12 UTSW 15 12236113 missense probably null 0.31
R6857:Mtmr12 UTSW 15 12263832 missense probably damaging 1.00
R7068:Mtmr12 UTSW 15 12257670 missense probably null 0.08
R7511:Mtmr12 UTSW 15 12265595 missense possibly damaging 0.94
R7515:Mtmr12 UTSW 15 12269951 missense probably damaging 1.00
R7607:Mtmr12 UTSW 15 12257708 nonsense probably null
R7709:Mtmr12 UTSW 15 12245011 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-02-01