Incidental Mutation 'R4287:Rrs1'
ID 368371
Institutional Source Beutler Lab
Gene Symbol Rrs1
Ensembl Gene ENSMUSG00000061024
Gene Name ribosome biogenesis regulator 1
Synonyms D1Ertd701e, 5730466A07Rik
MMRRC Submission 041652-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4287 (G1)
Quality Score 64
Status Validated
Chromosome 1
Chromosomal Location 9615633-9617680 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 9616448 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 234 (R234C)
Ref Sequence ENSEMBL: ENSMUSP00000071955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027044] [ENSMUST00000072079] [ENSMUST00000130927] [ENSMUST00000144177] [ENSMUST00000186467]
AlphaFold Q9CYH6
Predicted Effect probably benign
Transcript: ENSMUST00000027044
Predicted Effect possibly damaging
Transcript: ENSMUST00000072079
AA Change: R234C

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071955
Gene: ENSMUSG00000061024
AA Change: R234C

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:RRS1 31 193 3.5e-62 PFAM
low complexity region 302 337 N/A INTRINSIC
low complexity region 351 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130927
Predicted Effect probably benign
Transcript: ENSMUST00000144177
SMART Domains Protein: ENSMUSP00000116627
Gene: ENSMUSG00000025911

DomainStartEndE-ValueType
Pfam:Fe-ADH 50 454 2.1e-105 PFAM
Pfam:Fe-ADH_2 53 155 6.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186467
Predicted Effect probably benign
Transcript: ENSMUST00000190654
Meta Mutation Damage Score 0.1965 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,938,664 (GRCm39) V362A probably benign Het
Ash1l T A 3: 88,973,722 (GRCm39) C2594S probably damaging Het
Ccdc82 C A 9: 13,253,043 (GRCm39) Q303K probably benign Het
Cog1 A G 11: 113,544,853 (GRCm39) Y345C probably damaging Het
Fpgt T C 3: 154,796,997 (GRCm39) probably benign Het
Glrb A T 3: 80,752,539 (GRCm39) V408D possibly damaging Het
Gm7135 A G 1: 97,328,123 (GRCm39) noncoding transcript Het
Il1rn T C 2: 24,239,557 (GRCm39) L151P probably damaging Het
Itgav G T 2: 83,555,184 (GRCm39) E36* probably null Het
Kidins220 G A 12: 25,106,845 (GRCm39) E1433K possibly damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klra3 A G 6: 130,311,265 (GRCm39) C39R probably benign Het
Lce1i A G 3: 92,684,742 (GRCm39) S145P unknown Het
Memo1 T C 17: 74,562,293 (GRCm39) probably null Het
Mpp3 G A 11: 101,914,289 (GRCm39) A102V probably damaging Het
Mug2 T A 6: 122,040,632 (GRCm39) D727E probably benign Het
Ndufb8 T C 19: 44,541,130 (GRCm39) I107V probably benign Het
Or5h18 A T 16: 58,847,976 (GRCm39) M98K probably benign Het
Pnn C T 12: 59,118,956 (GRCm39) T513I possibly damaging Het
Ric8a A G 7: 140,441,335 (GRCm39) Y210C probably damaging Het
Ripor2 G A 13: 24,908,992 (GRCm39) V1037M probably damaging Het
Rreb1 A T 13: 38,115,907 (GRCm39) T1089S probably benign Het
Sec23ip A G 7: 128,379,057 (GRCm39) D838G probably benign Het
Setbp1 T C 18: 78,902,276 (GRCm39) I464V probably benign Het
Slc25a51 C T 4: 45,399,768 (GRCm39) V141M probably benign Het
Slc41a3 A T 6: 90,617,904 (GRCm39) H310L probably benign Het
Smurf1 A G 5: 144,828,268 (GRCm39) S363P probably benign Het
Tln1 C T 4: 43,543,509 (GRCm39) R1269Q probably benign Het
Tmed3 A G 9: 89,586,951 (GRCm39) S10P probably benign Het
Tomm70a T G 16: 56,960,985 (GRCm39) Y313D probably damaging Het
Umodl1 A G 17: 31,207,039 (GRCm39) E810G probably benign Het
Unc5c T C 3: 141,420,435 (GRCm39) I52T probably damaging Het
Unc5d T A 8: 29,209,824 (GRCm39) Y432F probably benign Het
Vmn2r97 A T 17: 19,168,337 (GRCm39) probably benign Het
Zfp629 T C 7: 127,211,110 (GRCm39) Y233C probably damaging Het
Zfp986 T C 4: 145,619,088 (GRCm39) probably null Het
Other mutations in Rrs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03098:Rrs1 UTSW 1 9,616,328 (GRCm39) frame shift probably null
PIT1430001:Rrs1 UTSW 1 9,616,150 (GRCm39) missense probably damaging 1.00
R0207:Rrs1 UTSW 1 9,615,992 (GRCm39) missense probably damaging 0.96
R0207:Rrs1 UTSW 1 9,615,987 (GRCm39) splice site probably null
R0577:Rrs1 UTSW 1 9,616,026 (GRCm39) splice site probably null
R1165:Rrs1 UTSW 1 9,615,992 (GRCm39) missense probably damaging 0.96
R1222:Rrs1 UTSW 1 9,616,080 (GRCm39) missense probably benign 0.00
R1238:Rrs1 UTSW 1 9,616,026 (GRCm39) splice site probably null
R1397:Rrs1 UTSW 1 9,615,992 (GRCm39) missense probably damaging 0.96
R1598:Rrs1 UTSW 1 9,616,137 (GRCm39) missense probably benign 0.15
R2338:Rrs1 UTSW 1 9,616,026 (GRCm39) splice site probably null
R4280:Rrs1 UTSW 1 9,616,364 (GRCm39) missense probably damaging 0.96
R4287:Rrs1 UTSW 1 9,616,440 (GRCm39) missense probably damaging 1.00
R4298:Rrs1 UTSW 1 9,616,448 (GRCm39) missense possibly damaging 0.82
R4326:Rrs1 UTSW 1 9,616,566 (GRCm39) missense possibly damaging 0.95
R4475:Rrs1 UTSW 1 9,615,810 (GRCm39) missense probably damaging 1.00
R4566:Rrs1 UTSW 1 9,616,452 (GRCm39) missense probably damaging 1.00
R4986:Rrs1 UTSW 1 9,615,992 (GRCm39) missense probably damaging 0.96
R6597:Rrs1 UTSW 1 9,616,601 (GRCm39) missense probably damaging 0.98
R7529:Rrs1 UTSW 1 9,616,417 (GRCm39) missense probably benign
R7728:Rrs1 UTSW 1 9,616,623 (GRCm39) missense possibly damaging 0.78
R8134:Rrs1 UTSW 1 9,615,645 (GRCm39) unclassified probably benign
R8799:Rrs1 UTSW 1 9,615,819 (GRCm39) missense probably damaging 1.00
R9060:Rrs1 UTSW 1 9,616,677 (GRCm39) missense probably damaging 1.00
R9360:Rrs1 UTSW 1 9,616,845 (GRCm39) makesense probably null
R9609:Rrs1 UTSW 1 9,616,518 (GRCm39) missense probably benign 0.30
R9685:Rrs1 UTSW 1 9,616,390 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGTTCGCCAAGAGGACTCAG -3'
(R):5'- TGCCAGCTAAAGCAGAAGGC -3'

Sequencing Primer
(F):5'- CCAAGAGGACTCAGGCCAAG -3'
(R):5'- AGGAATGCTTTTTGCTTCCCAAG -3'
Posted On 2016-02-02