Mutagenetix > Incidental Mutations

Incidental Mutation 'R4287:Mpp3'

368373

Institutional Source

Beutler Lab

Gene Symbol

Mpp3

Ensembl Gene

ENSMUSG00000052373

Gene Name

membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)

Synonyms

Dlgh3

MMRRC Submission

041652-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4287 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101999652-102028461 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 102023463 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 102 (A102V)

Ref Sequence

ENSEMBL: ENSMUSP00000102786 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062801] [ENSMUST00000100400] [ENSMUST00000107167] [ENSMUST00000107168]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000062801
AA Change: A102V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000055469
Gene: ENSMUSG00000052373
AA Change: A102V

Domain	Start	End	E-Value	Type
L27	10	64	1.5e-8	SMART
L27	68	121	1.18e-15	SMART
PDZ	145	218	1.06e-13	SMART
SH3	229	295	7.7e-9	SMART
GuKc	384	573	1.76e-70	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000100400
AA Change: A102V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097969
Gene: ENSMUSG00000052373
AA Change: A102V

Domain	Start	End	E-Value	Type
L27	10	64	1.5e-8	SMART
L27	68	121	1.18e-15	SMART
PDZ	145	218	1.06e-13	SMART
SH3	229	295	7.7e-9	SMART
GuKc	384	573	1.76e-70	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107167
AA Change: A102V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102785
Gene: ENSMUSG00000052373
AA Change: A102V

Domain	Start	End	E-Value	Type
L27	10	64	1.5e-8	SMART
L27	68	121	1.18e-15	SMART
PDZ	145	215	5.86e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107168
AA Change: A102V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102786
Gene: ENSMUSG00000052373
AA Change: A102V

Domain	Start	End	E-Value	Type
L27	10	64	1.5e-8	SMART
L27	68	121	1.18e-15	SMART
PDZ	145	218	1.06e-13	SMART
SH3	229	295	7.7e-9	SMART
GuKc	384	573	1.76e-70	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141403

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147838

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155751

Meta Mutation Damage Score

0.6047

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologs). MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intracellular junctions. This protein contains a conserved sequence, called the SH3 (src homology 3) motif, found in several other proteins that associate with the cytoskeleton and are suspected to play important roles in signal transduction. Alternatively spliced transcript variants have been identified. One transcript variant is experimentally supported, but it doesn't encode a protein. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc5	A	G	5: 122,800,601	V362A	probably benign	Het
Ash1l	T	A	3: 89,066,415	C2594S	probably damaging	Het
Ccdc82	C	A	9: 13,253,418	Q303K	probably benign	Het
Cog1	A	G	11: 113,654,027	Y345C	probably damaging	Het
Fpgt	T	C	3: 155,091,360		probably benign	Het
Glrb	A	T	3: 80,845,232	V408D	possibly damaging	Het
Gm7135	A	G	1: 97,400,398		noncoding transcript	Het
Il1rn	T	C	2: 24,349,545	L151P	probably damaging	Het
Itgav	G	T	2: 83,724,840	E36*	probably null	Het
Kidins220	G	A	12: 25,056,846	E1433K	possibly damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra3	A	G	6: 130,334,302	C39R	probably benign	Het
Lce1i	A	G	3: 92,777,435	S145P	unknown	Het
Memo1	T	C	17: 74,255,298		probably null	Het
Mug2	T	A	6: 122,063,673	D727E	probably benign	Het
Ndufb8	T	C	19: 44,552,691	I107V	probably benign	Het
Olfr186	A	T	16: 59,027,613	M98K	probably benign	Het
Pnn	C	T	12: 59,072,170	T513I	possibly damaging	Het
Ric8a	A	G	7: 140,861,422	Y210C	probably damaging	Het
Ripor2	G	A	13: 24,725,009	V1037M	probably damaging	Het
Rreb1	A	T	13: 37,931,931	T1089S	probably benign	Het
Rrs1	C	T	1: 9,546,215	S231L	probably damaging	Het
Rrs1	C	T	1: 9,546,223	R234C	possibly damaging	Het
Sec23ip	A	G	7: 128,777,333	D838G	probably benign	Het
Setbp1	T	C	18: 78,859,061	I464V	probably benign	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
Slc41a3	A	T	6: 90,640,922	H310L	probably benign	Het
Smurf1	A	G	5: 144,891,458	S363P	probably benign	Het
Tln1	C	T	4: 43,543,509	R1269Q	probably benign	Het
Tmed3	A	G	9: 89,704,898	S10P	probably benign	Het
Tomm70a	T	G	16: 57,140,622	Y313D	probably damaging	Het
Umodl1	A	G	17: 30,988,065	E810G	probably benign	Het
Unc5c	T	C	3: 141,714,674	I52T	probably damaging	Het
Unc5d	T	A	8: 28,719,796	Y432F	probably benign	Het
Vmn2r97	A	T	17: 18,948,075		probably benign	Het
Zfp629	T	C	7: 127,611,938	Y233C	probably damaging	Het
Zfp986	T	C	4: 145,892,518		probably null	Het

Other mutations in Mpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Mpp3	APN	11	102002103	missense	possibly damaging	0.76
IGL01337:Mpp3	APN	11	102000585	missense	probably benign
IGL01393:Mpp3	APN	11	102025478	missense	probably damaging	0.99
IGL01544:Mpp3	APN	11	102018659	missense	possibly damaging	0.91
IGL02152:Mpp3	APN	11	102025390	nonsense	probably null
IGL02441:Mpp3	APN	11	102009675	missense	probably benign	0.00
IGL02656:Mpp3	APN	11	102008601	missense	probably benign
R0013:Mpp3	UTSW	11	102005425	missense	probably benign	0.27
R0117:Mpp3	UTSW	11	102000573	missense	probably damaging	1.00
R0564:Mpp3	UTSW	11	102005347	missense	possibly damaging	0.87
R1372:Mpp3	UTSW	11	102000575	missense	probably damaging	0.96
R1531:Mpp3	UTSW	11	102008649	missense	probably benign
R1639:Mpp3	UTSW	11	102023442	missense	probably damaging	1.00
R1720:Mpp3	UTSW	11	102025756	start codon destroyed	possibly damaging	0.79
R1968:Mpp3	UTSW	11	102018552	intron	probably benign
R2064:Mpp3	UTSW	11	102000690	missense	probably benign	0.01
R2363:Mpp3	UTSW	11	102020486	missense	probably damaging	1.00
R3775:Mpp3	UTSW	11	102023367	nonsense	probably null
R3776:Mpp3	UTSW	11	102023367	nonsense	probably null
R4208:Mpp3	UTSW	11	102000600	missense	probably benign
R4327:Mpp3	UTSW	11	102023511	intron	probably benign
R4329:Mpp3	UTSW	11	102023511	intron	probably benign
R4367:Mpp3	UTSW	11	102023420	missense	probably benign	0.01
R4856:Mpp3	UTSW	11	102025136	missense	probably benign
R4886:Mpp3	UTSW	11	102025136	missense	probably benign
R4904:Mpp3	UTSW	11	102000587	missense	probably benign	0.01
R4946:Mpp3	UTSW	11	102005022	missense	probably benign	0.01
R5405:Mpp3	UTSW	11	102010221	missense	probably benign
R5935:Mpp3	UTSW	11	102025415	missense	probably damaging	1.00
R6020:Mpp3	UTSW	11	102018539	intron	probably benign
R6056:Mpp3	UTSW	11	102011689	splice site	probably null
R6151:Mpp3	UTSW	11	102008566	missense	probably benign	0.11
R6677:Mpp3	UTSW	11	102008618	missense	probably benign
R6784:Mpp3	UTSW	11	102002148	critical splice acceptor site	probably null
R6855:Mpp3	UTSW	11	102013325	missense	probably benign	0.09
R7227:Mpp3	UTSW	11	102005078	missense	possibly damaging	0.90
R7635:Mpp3	UTSW	11	102025383	missense	probably damaging	0.97
R7974:Mpp3	UTSW	11	102008354	critical splice donor site	probably null
R8330:Mpp3	UTSW	11	102008627	missense	probably benign	0.20
R8331:Mpp3	UTSW	11	102011715	splice site	probably null
R8993:Mpp3	UTSW	11	102000665	missense	probably benign	0.03
R9154:Mpp3	UTSW	11	102020502	missense
Z1176:Mpp3	UTSW	11	102008356	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTCACTGTGAACTCGGGGAAG -3'
(R):5'- AAGTTGTGTCTCCTGGGACG -3'

Sequencing Primer
(F):5'- GGTGCCTTCCGGGTCTTC -3'
(R):5'- TGGAGAGAGAGCTGGAGTCCTG -3'

Posted On

2016-02-02