Mutagenetix > Incidental Mutations

Incidental Mutation 'R4196:2610507B11Rik'

368375

Institutional Source

Beutler Lab

Gene Symbol

2610507B11Rik

Ensembl Gene

ENSMUSG00000010277

Gene Name

RIKEN cDNA 2610507B11 gene

Synonyms

D11Bhm178e, D11Bhm179e, E1

MMRRC Submission

041027-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R4196 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78261752-78290623 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 78263556 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000010421 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010421]

AlphaFold

Q5SYL3

Predicted Effect

probably benign
Transcript: ENSMUST00000010421

SMART Domains

Protein: ENSMUSP00000010421
Gene: ENSMUSG00000010277

Domain	Start	End	E-Value	Type
low complexity region	3	21	N/A	INTRINSIC
Pfam:Fmp27	26	475	1.6e-45	PFAM
Pfam:Fmp27	446	674	3.2e-24	PFAM
low complexity region	719	734	N/A	INTRINSIC
low complexity region	785	798	N/A	INTRINSIC
low complexity region	859	872	N/A	INTRINSIC
Fmp27_GFWDK	1028	1160	3.01e-61	SMART
low complexity region	1415	1421	N/A	INTRINSIC
low complexity region	1690	1701	N/A	INTRINSIC
Pfam:Apt1	1703	2176	2.4e-112	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125459

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136184

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141331

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.8%

Validation Efficiency

100% (39/39)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acmsd	T	G	1: 127,749,194	L152R	probably damaging	Het
Ankle2	A	G	5: 110,244,543	K472E	possibly damaging	Het
Aup1	T	C	6: 83,055,230	V126A	probably damaging	Het
Baz1a	T	C	12: 54,911,415	Y1014C	probably damaging	Het
Bcl9	A	T	3: 97,216,368		probably benign	Het
Cnot2	A	T	10: 116,501,304	N221K	possibly damaging	Het
Col19a1	G	A	1: 24,534,052	S213L	unknown	Het
Eif4enif1	T	C	11: 3,243,186	V675A	possibly damaging	Het
Elp3	A	G	14: 65,548,002	L450P	probably damaging	Het
Erbb4	C	T	1: 68,343,855	D328N	possibly damaging	Het
Fbll1	T	A	11: 35,797,872	H188L	possibly damaging	Het
Frem2	A	G	3: 53,539,268	F2360L	possibly damaging	Het
Gm2396	A	G	9: 88,917,662		noncoding transcript	Het
Gulo	G	T	14: 65,988,253	P375T	possibly damaging	Het
Hspd1	T	C	1: 55,086,909	M11V	probably benign	Het
Ikbkap	A	T	4: 56,755,353	N1295K	probably damaging	Het
Itgav	A	G	2: 83,768,327	T243A	probably benign	Het
Lipg	C	T	18: 74,945,831	R450H	probably damaging	Het
Lrp3	T	A	7: 35,203,410	S504C	probably damaging	Het
Mrps9	T	G	1: 42,901,094		probably benign	Het
Nlgn1	A	G	3: 25,434,392	V564A	probably damaging	Het
Ntf3	T	C	6: 126,102,175	T110A	probably benign	Het
Pkd1l1	T	A	11: 8,909,929	I560F	probably damaging	Het
Prepl	T	C	17: 85,081,154	T174A	probably benign	Het
Ptprg	A	T	14: 12,122,002	T289S	possibly damaging	Het
Rab11fip2	T	C	19: 59,935,781	T222A	probably damaging	Het
Rhbdd3	G	T	11: 5,099,460		probably benign	Het
Sept4	C	A	11: 87,588,772	D239E	probably damaging	Het
Shprh	A	G	10: 11,207,860		probably benign	Het
Slc3a1	T	A	17: 85,060,878	W525R	probably damaging	Het
Trim75	A	G	8: 64,982,764	S345P	probably damaging	Het
Usp5	C	T	6: 124,824,938	E72K	possibly damaging	Het
Vmn1r225	T	A	17: 20,502,975	M226K	probably benign	Het
Wnk4	T	A	11: 101,269,631	V697E	probably damaging	Het
Zbtb9	C	T	17: 26,973,879	T86I	probably benign	Het

Other mutations in 2610507B11Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:2610507B11Rik	APN	11	78269574	missense	possibly damaging	0.55
IGL00497:2610507B11Rik	APN	11	78272933	missense	probably damaging	1.00
IGL00797:2610507B11Rik	APN	11	78273150	missense	probably benign	0.07
IGL01695:2610507B11Rik	APN	11	78265193	missense	probably benign	0.03
IGL02055:2610507B11Rik	APN	11	78286631	missense	probably damaging	1.00
IGL02066:2610507B11Rik	APN	11	78273232	missense	probably damaging	1.00
IGL02231:2610507B11Rik	APN	11	78279896	missense	probably benign
IGL02282:2610507B11Rik	APN	11	78284228	missense	probably benign	0.22
IGL02293:2610507B11Rik	APN	11	78271910	missense	probably damaging	1.00
IGL02336:2610507B11Rik	APN	11	78289032	missense	probably damaging	1.00
IGL02528:2610507B11Rik	APN	11	78271976	missense	possibly damaging	0.93
IGL03231:2610507B11Rik	APN	11	78268702	missense	probably benign	0.02
R0003:2610507B11Rik	UTSW	11	78286578	missense	possibly damaging	0.66
R0197:2610507B11Rik	UTSW	11	78269704	unclassified	probably benign
R0244:2610507B11Rik	UTSW	11	78286491	splice site	probably null
R0281:2610507B11Rik	UTSW	11	78271924	missense	possibly damaging	0.88
R0396:2610507B11Rik	UTSW	11	78268377	missense	possibly damaging	0.93
R0624:2610507B11Rik	UTSW	11	78268457	missense	probably damaging	1.00
R0666:2610507B11Rik	UTSW	11	78287987	missense	probably damaging	1.00
R0666:2610507B11Rik	UTSW	11	78277212	nonsense	probably null
R1313:2610507B11Rik	UTSW	11	78265672	missense	probably benign	0.02
R1313:2610507B11Rik	UTSW	11	78265672	missense	probably benign	0.02
R1443:2610507B11Rik	UTSW	11	78262798	missense	probably damaging	1.00
R1485:2610507B11Rik	UTSW	11	78285580	missense	probably damaging	1.00
R1500:2610507B11Rik	UTSW	11	78284132	missense	possibly damaging	0.46
R1537:2610507B11Rik	UTSW	11	78289343	missense	probably damaging	1.00
R1543:2610507B11Rik	UTSW	11	78275174	missense	probably benign	0.44
R1702:2610507B11Rik	UTSW	11	78289028	missense	probably damaging	1.00
R1804:2610507B11Rik	UTSW	11	78273469	missense	probably damaging	1.00
R1835:2610507B11Rik	UTSW	11	78287750	missense	probably damaging	0.97
R1852:2610507B11Rik	UTSW	11	78268473	missense	probably damaging	1.00
R1861:2610507B11Rik	UTSW	11	78287929	unclassified	probably benign
R1986:2610507B11Rik	UTSW	11	78274612	missense	probably damaging	1.00
R1987:2610507B11Rik	UTSW	11	78268167	missense	probably damaging	1.00
R2061:2610507B11Rik	UTSW	11	78268749	nonsense	probably null
R2113:2610507B11Rik	UTSW	11	78268772	missense	probably benign	0.02
R3692:2610507B11Rik	UTSW	11	78269509	missense	probably damaging	1.00
R3788:2610507B11Rik	UTSW	11	78288297	critical splice donor site	probably null
R3835:2610507B11Rik	UTSW	11	78279085	missense	probably benign	0.17
R3882:2610507B11Rik	UTSW	11	78262700	missense	probably damaging	1.00
R3943:2610507B11Rik	UTSW	11	78269524	nonsense	probably null
R3944:2610507B11Rik	UTSW	11	78269524	nonsense	probably null
R3945:2610507B11Rik	UTSW	11	78289964	missense	probably damaging	1.00
R4510:2610507B11Rik	UTSW	11	78277328	missense	possibly damaging	0.59
R4511:2610507B11Rik	UTSW	11	78277328	missense	possibly damaging	0.59
R4756:2610507B11Rik	UTSW	11	78264028	missense	probably damaging	0.98
R5337:2610507B11Rik	UTSW	11	78265208	missense	possibly damaging	0.46
R5419:2610507B11Rik	UTSW	11	78272090	nonsense	probably null
R5572:2610507B11Rik	UTSW	11	78264567	missense	probably damaging	0.98
R5719:2610507B11Rik	UTSW	11	78273245	missense	probably damaging	0.97
R5754:2610507B11Rik	UTSW	11	78269541	missense	probably damaging	1.00
R5890:2610507B11Rik	UTSW	11	78273270	nonsense	probably null
R5919:2610507B11Rik	UTSW	11	78289350	missense	probably damaging	1.00
R5925:2610507B11Rik	UTSW	11	78284238	missense	probably benign	0.06
R5976:2610507B11Rik	UTSW	11	78284129	missense	probably benign	0.00
R5999:2610507B11Rik	UTSW	11	78285468	missense	probably damaging	1.00
R6056:2610507B11Rik	UTSW	11	78271384	missense	possibly damaging	0.77
R6180:2610507B11Rik	UTSW	11	78273258	missense	possibly damaging	0.51
R6484:2610507B11Rik	UTSW	11	78279095	missense	probably damaging	1.00
R6721:2610507B11Rik	UTSW	11	78279799	missense	probably damaging	1.00
R6800:2610507B11Rik	UTSW	11	78288279	missense	probably benign	0.13
R6911:2610507B11Rik	UTSW	11	78268353	missense	probably damaging	0.99
R6923:2610507B11Rik	UTSW	11	78274626	missense	possibly damaging	0.67
R7283:2610507B11Rik	UTSW	11	78274828	missense	probably damaging	1.00
R7287:2610507B11Rik	UTSW	11	78272883	missense	possibly damaging	0.61
R7339:2610507B11Rik	UTSW	11	78272384	critical splice donor site	probably null
R7409:2610507B11Rik	UTSW	11	78268757	missense	probably damaging	1.00
R7473:2610507B11Rik	UTSW	11	78267115	missense	possibly damaging	0.86
R7704:2610507B11Rik	UTSW	11	78268744	missense	probably benign	0.29
R7793:2610507B11Rik	UTSW	11	78273205	missense	possibly damaging	0.56
R8051:2610507B11Rik	UTSW	11	78273412	intron	probably benign
R8186:2610507B11Rik	UTSW	11	78286631	missense	probably damaging	1.00
R8256:2610507B11Rik	UTSW	11	78277153	missense	probably benign	0.00
R8518:2610507B11Rik	UTSW	11	78265238	missense	possibly damaging	0.95
R8677:2610507B11Rik	UTSW	11	78284156	missense	probably damaging	1.00
R8736:2610507B11Rik	UTSW	11	78288049	missense	probably benign	0.26
R8829:2610507B11Rik	UTSW	11	78267238	missense	probably benign	0.02
R8832:2610507B11Rik	UTSW	11	78267238	missense	probably benign	0.02
R9006:2610507B11Rik	UTSW	11	78273519	missense	possibly damaging	0.90
R9014:2610507B11Rik	UTSW	11	78269662	missense	possibly damaging	0.78
R9184:2610507B11Rik	UTSW	11	78271388	missense	probably damaging	1.00
R9473:2610507B11Rik	UTSW	11	78284157	missense	probably damaging	1.00
X0028:2610507B11Rik	UTSW	11	78286635	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGAACTGCTAAGCAAATTCAGC -3'
(R):5'- GTCTCACAAAACAGCACTTGG -3'

Sequencing Primer
(F):5'- TTCAGCTAACATCATCATGAGGAGC -3'
(R):5'- CTTGGACTAATAGGAGACTCCAGC -3'

Posted On

2016-02-02