Incidental Mutation 'R4196:2610507B11Rik'
ID368375
Institutional Source Beutler Lab
Gene Symbol 2610507B11Rik
Ensembl Gene ENSMUSG00000010277
Gene NameRIKEN cDNA 2610507B11 gene
SynonymsD11Bhm178e, D11Bhm179e, E1
MMRRC Submission 041027-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4196 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78261752-78290623 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 78263556 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000010421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010421]
Predicted Effect probably benign
Transcript: ENSMUST00000010421
SMART Domains Protein: ENSMUSP00000010421
Gene: ENSMUSG00000010277

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:Fmp27 26 475 1.6e-45 PFAM
Pfam:Fmp27 446 674 3.2e-24 PFAM
low complexity region 719 734 N/A INTRINSIC
low complexity region 785 798 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Fmp27_GFWDK 1028 1160 3.01e-61 SMART
low complexity region 1415 1421 N/A INTRINSIC
low complexity region 1690 1701 N/A INTRINSIC
Pfam:Apt1 1703 2176 2.4e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141331
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Ankle2 A G 5: 110,244,543 K472E possibly damaging Het
Aup1 T C 6: 83,055,230 V126A probably damaging Het
Baz1a T C 12: 54,911,415 Y1014C probably damaging Het
Bcl9 A T 3: 97,216,368 probably benign Het
Cnot2 A T 10: 116,501,304 N221K possibly damaging Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Elp3 A G 14: 65,548,002 L450P probably damaging Het
Erbb4 C T 1: 68,343,855 D328N possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gulo G T 14: 65,988,253 P375T possibly damaging Het
Hspd1 T C 1: 55,086,909 M11V probably benign Het
Ikbkap A T 4: 56,755,353 N1295K probably damaging Het
Itgav A G 2: 83,768,327 T243A probably benign Het
Lipg C T 18: 74,945,831 R450H probably damaging Het
Lrp3 T A 7: 35,203,410 S504C probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Nlgn1 A G 3: 25,434,392 V564A probably damaging Het
Ntf3 T C 6: 126,102,175 T110A probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Prepl T C 17: 85,081,154 T174A probably benign Het
Ptprg A T 14: 12,122,002 T289S possibly damaging Het
Rab11fip2 T C 19: 59,935,781 T222A probably damaging Het
Rhbdd3 G T 11: 5,099,460 probably benign Het
Sept4 C A 11: 87,588,772 D239E probably damaging Het
Shprh A G 10: 11,207,860 probably benign Het
Slc3a1 T A 17: 85,060,878 W525R probably damaging Het
Trim75 A G 8: 64,982,764 S345P probably damaging Het
Usp5 C T 6: 124,824,938 E72K possibly damaging Het
Vmn1r225 T A 17: 20,502,975 M226K probably benign Het
Wnk4 T A 11: 101,269,631 V697E probably damaging Het
Zbtb9 C T 17: 26,973,879 T86I probably benign Het
Other mutations in 2610507B11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:2610507B11Rik APN 11 78269574 missense possibly damaging 0.55
IGL00497:2610507B11Rik APN 11 78272933 missense probably damaging 1.00
IGL00797:2610507B11Rik APN 11 78273150 missense probably benign 0.07
IGL01695:2610507B11Rik APN 11 78265193 missense probably benign 0.03
IGL02055:2610507B11Rik APN 11 78286631 missense probably damaging 1.00
IGL02066:2610507B11Rik APN 11 78273232 missense probably damaging 1.00
IGL02231:2610507B11Rik APN 11 78279896 missense probably benign
IGL02282:2610507B11Rik APN 11 78284228 missense probably benign 0.22
IGL02293:2610507B11Rik APN 11 78271910 missense probably damaging 1.00
IGL02336:2610507B11Rik APN 11 78289032 missense probably damaging 1.00
IGL02528:2610507B11Rik APN 11 78271976 missense possibly damaging 0.93
IGL03231:2610507B11Rik APN 11 78268702 missense probably benign 0.02
R0003:2610507B11Rik UTSW 11 78286578 missense possibly damaging 0.66
R0197:2610507B11Rik UTSW 11 78269704 unclassified probably benign
R0244:2610507B11Rik UTSW 11 78286491 unclassified probably null
R0281:2610507B11Rik UTSW 11 78271924 missense possibly damaging 0.88
R0396:2610507B11Rik UTSW 11 78268377 missense possibly damaging 0.93
R0624:2610507B11Rik UTSW 11 78268457 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78287987 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78277212 nonsense probably null
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1443:2610507B11Rik UTSW 11 78262798 missense probably damaging 1.00
R1485:2610507B11Rik UTSW 11 78285580 missense probably damaging 1.00
R1500:2610507B11Rik UTSW 11 78284132 missense possibly damaging 0.46
R1537:2610507B11Rik UTSW 11 78289343 missense probably damaging 1.00
R1543:2610507B11Rik UTSW 11 78275174 missense probably benign 0.44
R1702:2610507B11Rik UTSW 11 78289028 missense probably damaging 1.00
R1804:2610507B11Rik UTSW 11 78273469 missense probably damaging 1.00
R1835:2610507B11Rik UTSW 11 78287750 missense probably damaging 0.97
R1852:2610507B11Rik UTSW 11 78268473 missense probably damaging 1.00
R1861:2610507B11Rik UTSW 11 78287929 unclassified probably benign
R1986:2610507B11Rik UTSW 11 78274612 missense probably damaging 1.00
R1987:2610507B11Rik UTSW 11 78268167 missense probably damaging 1.00
R2061:2610507B11Rik UTSW 11 78268749 nonsense probably null
R2113:2610507B11Rik UTSW 11 78268772 missense probably benign 0.02
R3692:2610507B11Rik UTSW 11 78269509 missense probably damaging 1.00
R3788:2610507B11Rik UTSW 11 78288297 critical splice donor site probably null
R3835:2610507B11Rik UTSW 11 78279085 missense probably benign 0.17
R3882:2610507B11Rik UTSW 11 78262700 missense probably damaging 1.00
R3943:2610507B11Rik UTSW 11 78269524 nonsense probably null
R3944:2610507B11Rik UTSW 11 78269524 nonsense probably null
R3945:2610507B11Rik UTSW 11 78289964 missense probably damaging 1.00
R4510:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4511:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4756:2610507B11Rik UTSW 11 78264028 missense probably damaging 0.98
R5337:2610507B11Rik UTSW 11 78265208 missense possibly damaging 0.46
R5419:2610507B11Rik UTSW 11 78272090 nonsense probably null
R5572:2610507B11Rik UTSW 11 78264567 missense probably damaging 0.98
R5719:2610507B11Rik UTSW 11 78273245 missense probably damaging 0.97
R5754:2610507B11Rik UTSW 11 78269541 missense probably damaging 1.00
R5890:2610507B11Rik UTSW 11 78273270 nonsense probably null
R5919:2610507B11Rik UTSW 11 78289350 missense probably damaging 1.00
R5925:2610507B11Rik UTSW 11 78284238 missense probably benign 0.06
R5976:2610507B11Rik UTSW 11 78284129 missense probably benign 0.00
R5999:2610507B11Rik UTSW 11 78285468 missense probably damaging 1.00
R6056:2610507B11Rik UTSW 11 78271384 missense possibly damaging 0.77
R6180:2610507B11Rik UTSW 11 78273258 missense possibly damaging 0.51
R6484:2610507B11Rik UTSW 11 78279095 missense probably damaging 1.00
R6721:2610507B11Rik UTSW 11 78279799 missense probably damaging 1.00
R6800:2610507B11Rik UTSW 11 78288279 missense probably benign 0.13
R6911:2610507B11Rik UTSW 11 78268353 missense probably damaging 0.99
R6923:2610507B11Rik UTSW 11 78274626 missense possibly damaging 0.67
R7283:2610507B11Rik UTSW 11 78274828 missense probably damaging 1.00
R7287:2610507B11Rik UTSW 11 78272883 missense possibly damaging 0.61
R7339:2610507B11Rik UTSW 11 78272384 critical splice donor site probably null
R7409:2610507B11Rik UTSW 11 78268757 missense probably damaging 1.00
R7473:2610507B11Rik UTSW 11 78267115 missense possibly damaging 0.86
R7704:2610507B11Rik UTSW 11 78268744 missense probably benign 0.29
X0028:2610507B11Rik UTSW 11 78286635 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAACTGCTAAGCAAATTCAGC -3'
(R):5'- GTCTCACAAAACAGCACTTGG -3'

Sequencing Primer
(F):5'- TTCAGCTAACATCATCATGAGGAGC -3'
(R):5'- CTTGGACTAATAGGAGACTCCAGC -3'
Posted On2016-02-02