Incidental Mutation 'R4207:Adgrg4'
ID 368378
Institutional Source Beutler Lab
Gene Symbol Adgrg4
Ensembl Gene ENSMUSG00000053852
Gene Name adhesion G protein-coupled receptor G4
Synonyms Gpr112, PGR17, LOC236798
MMRRC Submission 041036-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R4207 (G1)
Quality Score 36
Status Validated
Chromosome X
Chromosomal Location 55939594-56025719 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 55964109 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1893 (V1893I)
Ref Sequence ENSEMBL: ENSMUSP00000119486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136396] [ENSMUST00000153784] [ENSMUST00000154818] [ENSMUST00000168724]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000136396
AA Change: V2035I

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116655
Gene: ENSMUSG00000053852
AA Change: V2035I

DomainStartEndE-ValueType
SCOP:d1saca_ 2 159 5e-14 SMART
low complexity region 242 261 N/A INTRINSIC
low complexity region 310 321 N/A INTRINSIC
internal_repeat_1 459 720 5.68e-5 PROSPERO
internal_repeat_1 719 999 5.68e-5 PROSPERO
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1051 1066 N/A INTRINSIC
low complexity region 1079 1101 N/A INTRINSIC
low complexity region 1243 1261 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1536 1550 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
low complexity region 1843 1864 N/A INTRINSIC
low complexity region 1892 1911 N/A INTRINSIC
low complexity region 1953 1970 N/A INTRINSIC
low complexity region 2068 2076 N/A INTRINSIC
low complexity region 2257 2269 N/A INTRINSIC
GPS 2384 2436 1.79e-18 SMART
Pfam:7tm_2 2443 2684 4.8e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153784
AA Change: V2098I

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116634
Gene: ENSMUSG00000053852
AA Change: V2098I

DomainStartEndE-ValueType
SCOP:d1saca_ 28 222 1e-17 SMART
low complexity region 305 324 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
internal_repeat_1 522 783 2.5e-5 PROSPERO
internal_repeat_1 782 1062 2.5e-5 PROSPERO
low complexity region 1076 1087 N/A INTRINSIC
low complexity region 1114 1129 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1306 1324 N/A INTRINSIC
low complexity region 1409 1420 N/A INTRINSIC
low complexity region 1599 1613 N/A INTRINSIC
low complexity region 1643 1659 N/A INTRINSIC
low complexity region 1906 1927 N/A INTRINSIC
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 2016 2033 N/A INTRINSIC
low complexity region 2131 2139 N/A INTRINSIC
low complexity region 2289 2300 N/A INTRINSIC
low complexity region 2459 2471 N/A INTRINSIC
GPS 2631 2683 1.79e-18 SMART
Pfam:7tm_2 2691 2932 8.6e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000154818
AA Change: V1893I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119486
Gene: ENSMUSG00000053852
AA Change: V1893I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 100 119 N/A INTRINSIC
low complexity region 168 179 N/A INTRINSIC
internal_repeat_1 317 578 4.23e-5 PROSPERO
internal_repeat_1 577 857 4.23e-5 PROSPERO
low complexity region 871 882 N/A INTRINSIC
low complexity region 909 924 N/A INTRINSIC
low complexity region 937 959 N/A INTRINSIC
low complexity region 1101 1119 N/A INTRINSIC
low complexity region 1204 1215 N/A INTRINSIC
low complexity region 1394 1408 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1701 1722 N/A INTRINSIC
low complexity region 1750 1769 N/A INTRINSIC
low complexity region 1811 1828 N/A INTRINSIC
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 2084 2095 N/A INTRINSIC
low complexity region 2254 2266 N/A INTRINSIC
GPS 2426 2478 1.79e-18 SMART
Pfam:7tm_2 2485 2727 3.9e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168724
SMART Domains Protein: ENSMUSP00000127627
Gene: ENSMUSG00000053852

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor belonging to a large family of diverse integral membrane proteins that participate in various physiological functions. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The ligand for this family member is unknown, and it is therefore an orphan receptor. This receptor is known to be expressed in normal enterochromaffin cells and in gastrointestinal neuroendocrine carcinoma cells, and it is therefore considered to be a novel biomarker or target for immunotherapy. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,872,551 (GRCm39) Q17* probably null Het
Acap2 T A 16: 30,938,245 (GRCm39) N293I probably damaging Het
Aff1 T C 5: 103,966,854 (GRCm39) probably null Het
Ap1b1 A G 11: 4,981,637 (GRCm39) D515G probably damaging Het
Brk1 T C 6: 113,592,805 (GRCm39) Y63H possibly damaging Het
Cand1 T C 10: 119,047,750 (GRCm39) D580G probably damaging Het
Casp4 A G 9: 5,328,451 (GRCm39) D311G probably benign Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,973 (GRCm39) V1033F probably damaging Het
Dhx29 G T 13: 113,064,483 (GRCm39) A53S probably benign Het
Dis3 T G 14: 99,332,752 (GRCm39) I227L probably benign Het
Efhc2 T C X: 17,096,789 (GRCm39) N186S possibly damaging Het
Efl1 T C 7: 82,400,024 (GRCm39) V592A probably damaging Het
Elovl7 A T 13: 108,419,040 (GRCm39) Q224L possibly damaging Het
Fcgr3 T A 1: 170,881,644 (GRCm39) K160N probably benign Het
Flg A G 3: 93,187,169 (GRCm39) Y207C probably benign Het
Fmn2 A G 1: 174,409,521 (GRCm39) T585A unknown Het
Gm7135 T C 1: 97,397,620 (GRCm39) noncoding transcript Het
Gm8104 G T 14: 42,959,091 (GRCm39) D94Y probably damaging Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Ino80b G C 6: 83,099,314 (GRCm39) P178R probably damaging Het
Kbtbd4 T C 2: 90,740,099 (GRCm39) F495L probably damaging Het
Lingo2 T C 4: 35,709,810 (GRCm39) I57V probably benign Het
Me2 T C 18: 73,924,156 (GRCm39) K352R probably benign Het
Mthfsd A G 8: 121,832,365 (GRCm39) V133A probably damaging Het
Nav2 T A 7: 49,222,046 (GRCm39) probably null Het
Nav2 T A 7: 49,246,979 (GRCm39) I2168N probably damaging Het
Nlrp10 T A 7: 108,523,548 (GRCm39) D644V possibly damaging Het
Oplah C T 15: 76,186,910 (GRCm39) R635H probably damaging Het
Or10n1 A G 9: 39,525,253 (GRCm39) Y130C possibly damaging Het
Or2c1 T C 16: 3,657,434 (GRCm39) L199P probably damaging Het
Or5b117 T C 19: 13,431,835 (GRCm39) I15M probably benign Het
Peli1 A G 11: 21,097,115 (GRCm39) probably null Het
Pfkfb1 A T X: 149,405,184 (GRCm39) D208V possibly damaging Het
Pld5 T G 1: 175,821,441 (GRCm39) T242P probably damaging Het
Rbm5 A G 9: 107,627,682 (GRCm39) S420P probably benign Het
Rhag A T 17: 41,142,544 (GRCm39) I250F probably damaging Het
Rnase4 A G 14: 51,342,462 (GRCm39) K62R probably benign Het
Scaf4 C T 16: 90,057,103 (GRCm39) V83I unknown Het
Slc24a2 A G 4: 87,145,442 (GRCm39) V204A probably damaging Het
Slc5a8 G T 10: 88,747,275 (GRCm39) L409F probably damaging Het
Spns3 A T 11: 72,429,187 (GRCm39) V199E probably damaging Het
Sspo A G 6: 48,455,227 (GRCm39) T3030A probably benign Het
Sstr2 A C 11: 113,515,482 (GRCm39) T134P probably damaging Het
Stk39 G T 2: 68,051,264 (GRCm39) T527K probably benign Het
Sult2a1 T A 7: 13,535,472 (GRCm39) T194S probably benign Het
Tamm41 AGGG AGG 6: 114,989,320 (GRCm39) probably benign Het
Trav7-3 A G 14: 53,681,203 (GRCm39) T82A probably benign Het
Umodl1 G A 17: 31,178,341 (GRCm39) V106I probably damaging Het
Vmn2r85 A C 10: 130,254,574 (GRCm39) C703W probably damaging Het
Vmn2r92 G A 17: 18,404,523 (GRCm39) V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 (GRCm39) I2322V probably benign Het
Zfp644 T C 5: 106,766,142 (GRCm39) E93G probably damaging Het
Zfp81 C T 17: 33,553,890 (GRCm39) C308Y probably damaging Het
Other mutations in Adgrg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03215:Adgrg4 APN X 56,022,956 (GRCm39) missense probably damaging 1.00
R3407:Adgrg4 UTSW X 56,013,487 (GRCm39) missense probably damaging 0.97
R3408:Adgrg4 UTSW X 56,013,487 (GRCm39) missense probably damaging 0.97
R3947:Adgrg4 UTSW X 55,963,114 (GRCm39) missense probably benign 0.25
R3948:Adgrg4 UTSW X 55,963,114 (GRCm39) missense probably benign 0.25
R4067:Adgrg4 UTSW X 56,005,320 (GRCm39) missense probably damaging 1.00
R4393:Adgrg4 UTSW X 55,977,703 (GRCm39) missense probably damaging 1.00
R4395:Adgrg4 UTSW X 55,977,703 (GRCm39) missense probably damaging 1.00
R4397:Adgrg4 UTSW X 55,977,703 (GRCm39) missense probably damaging 1.00
R4504:Adgrg4 UTSW X 55,961,802 (GRCm39) missense possibly damaging 0.63
Z1176:Adgrg4 UTSW X 55,959,619 (GRCm39) missense probably benign 0.00
Z1176:Adgrg4 UTSW X 55,940,062 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCACTTCTACAACTACACTGG -3'
(R):5'- AAGGATGTGCCATCTCAGTAGAC -3'

Sequencing Primer
(F):5'- TGGACATCATCACTGCTAACTC -3'
(R):5'- TGTGCCATCTCAGTAGACATCAGG -3'
Posted On 2016-02-03