Incidental Mutation 'R4130:Adam12'
ID368390
Institutional Source Beutler Lab
Gene Symbol Adam12
Ensembl Gene ENSMUSG00000054555
Gene Namea disintegrin and metallopeptidase domain 12 (meltrin alpha)
SynonymsMltna, ADAM12
MMRRC Submission 041636-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R4130 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location133883199-134232146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 133912924 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 345 (V345I)
Ref Sequence ENSEMBL: ENSMUSP00000114874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067680] [ENSMUST00000138363]
Predicted Effect probably damaging
Transcript: ENSMUST00000067680
AA Change: V667I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065213
Gene: ENSMUSG00000054555
AA Change: V667I

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 165 1.1e-27 PFAM
Pfam:Reprolysin_5 210 392 2.1e-24 PFAM
Pfam:Reprolysin_4 210 408 3.8e-16 PFAM
Pfam:Reprolysin 212 414 1.4e-74 PFAM
Pfam:Reprolysin_2 232 404 6e-18 PFAM
Pfam:Reprolysin_3 236 359 1.3e-16 PFAM
DISIN 431 506 4.29e-42 SMART
ACR 507 650 1.75e-67 SMART
transmembrane domain 705 727 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138363
AA Change: V345I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114874
Gene: ENSMUSG00000054555
AA Change: V345I

DomainStartEndE-ValueType
Pfam:Reprolysin 4 92 4.5e-24 PFAM
Pfam:Reprolysin_2 6 82 2.1e-11 PFAM
Pfam:Reprolysin_5 9 70 2.8e-11 PFAM
Pfam:Reprolysin_4 11 87 8.9e-8 PFAM
DISIN 109 184 4.29e-42 SMART
ACR 185 328 1.75e-67 SMART
transmembrane domain 383 405 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein that localizes to the cell surface. About a third of the mice lacking the encoded protein die before weaning. Overexpression of the encoded protein in a mouse model of Duchenne muscular dystrophy alleviates the muscle pathology by preventing cell necrosis and inflammation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mice display partial postnatal lethality, decreased brown fat, and impaired formation of neck and interscapular muscles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik T C 10: 21,425,542 noncoding transcript Het
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Bbx T C 16: 50,224,858 K447E probably damaging Het
Bcar1 A G 8: 111,714,165 L399P possibly damaging Het
C87977 T A 4: 144,208,809 I121F probably damaging Het
Cytl1 T C 5: 37,735,641 S32P probably damaging Het
Eif4e1b C T 13: 54,787,317 T219M probably benign Het
F10 A G 8: 13,055,584 D383G possibly damaging Het
Gm37267 T G 1: 180,509,078 noncoding transcript Het
Golga2 G A 2: 32,288,166 R29H probably benign Het
Gpd1 A T 15: 99,719,277 probably null Het
Lrrk2 G A 15: 91,755,794 R1514Q probably benign Het
Map1b T C 13: 99,431,680 E1511G unknown Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr702 C T 7: 106,823,585 G314S probably benign Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Rab3gap2 A G 1: 185,204,297 D19G possibly damaging Het
Rnf213 T C 11: 119,483,006 S4972P probably damaging Het
Skap1 A G 11: 96,526,045 Y52C probably damaging Het
Sphkap T C 1: 83,277,898 N710S probably damaging Het
Tedc1 T A 12: 113,163,208 D363E probably benign Het
Vmn2r44 T A 7: 8,367,919 Q709H probably damaging Het
Wdr5 G T 2: 27,520,429 probably benign Het
Other mutations in Adam12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Adam12 APN 7 133909881 missense possibly damaging 0.51
IGL01403:Adam12 APN 7 133919610 missense probably benign 0.00
IGL01482:Adam12 APN 7 133967848 missense probably damaging 1.00
IGL01922:Adam12 APN 7 133937472 nonsense probably null
IGL02397:Adam12 APN 7 133909819 splice site probably benign
IGL03401:Adam12 APN 7 133916463 missense probably damaging 1.00
R0122:Adam12 UTSW 7 134012348 missense probably benign 0.45
R0200:Adam12 UTSW 7 133974416 splice site probably null
R0463:Adam12 UTSW 7 133974416 splice site probably null
R0927:Adam12 UTSW 7 133998230 missense probably damaging 1.00
R1258:Adam12 UTSW 7 133937447 missense probably damaging 1.00
R1440:Adam12 UTSW 7 133931814 missense probably benign 0.03
R1483:Adam12 UTSW 7 133930025 missense probably benign 0.41
R1692:Adam12 UTSW 7 133887944 makesense probably null
R1797:Adam12 UTSW 7 133967861 missense probably benign 0.03
R2134:Adam12 UTSW 7 134012288 nonsense probably null
R2230:Adam12 UTSW 7 133919618 missense probably damaging 1.00
R2350:Adam12 UTSW 7 133919524 missense probably damaging 1.00
R2944:Adam12 UTSW 7 133975507 missense probably null 0.02
R3688:Adam12 UTSW 7 133964796 nonsense probably null
R3747:Adam12 UTSW 7 134172865 missense probably damaging 0.96
R3749:Adam12 UTSW 7 134172865 missense probably damaging 0.96
R3750:Adam12 UTSW 7 134172865 missense probably damaging 0.96
R4028:Adam12 UTSW 7 133929996 missense probably damaging 1.00
R4131:Adam12 UTSW 7 133912924 missense probably damaging 1.00
R4346:Adam12 UTSW 7 133981535 missense possibly damaging 0.82
R4701:Adam12 UTSW 7 133916462 missense possibly damaging 0.64
R4887:Adam12 UTSW 7 134172821 missense possibly damaging 0.74
R5355:Adam12 UTSW 7 133887942 makesense probably null
R5468:Adam12 UTSW 7 133975473 missense probably damaging 1.00
R5486:Adam12 UTSW 7 133907672 missense possibly damaging 0.75
R5990:Adam12 UTSW 7 133931736 missense probably damaging 1.00
R6504:Adam12 UTSW 7 133929984 missense probably damaging 1.00
R6783:Adam12 UTSW 7 133974397 missense probably damaging 1.00
R7117:Adam12 UTSW 7 133916462 missense probably benign 0.00
R7263:Adam12 UTSW 7 133919511 missense possibly damaging 0.68
R7749:Adam12 UTSW 7 134224813 missense unknown
R7820:Adam12 UTSW 7 133998188 missense probably benign 0.00
R7880:Adam12 UTSW 7 133909962 missense possibly damaging 0.94
R7891:Adam12 UTSW 7 133998232 missense probably benign 0.00
R8114:Adam12 UTSW 7 133967888 missense probably damaging 1.00
R8160:Adam12 UTSW 7 133968041 splice site probably null
X0057:Adam12 UTSW 7 134012315 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTCCAATATCCACAGTTCCCAG -3'
(R):5'- CTCCACATTGTTCCAGGGTTG -3'

Sequencing Primer
(F):5'- AGCAGTCCATCATCTATTTTCTGGG -3'
(R):5'- CCACATTGTTCCAGGGTTGAAAAAG -3'
Posted On2016-02-03