Mutagenetix > Incidental Mutations

Incidental Mutation 'R4171:Kdm4c'

368393

Institutional Source

Beutler Lab

Gene Symbol

Kdm4c

Ensembl Gene

ENSMUSG00000028397

Gene Name

lysine (K)-specific demethylase 4C

Synonyms

Jmjd2c, 2410141F18Rik

MMRRC Submission

041011-MU

Accession Numbers

Genbank: NM_001172095; MGI: 1924054

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4171 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74242497-74405860 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 74280898 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 108 (Y108N)

Ref Sequence

ENSEMBL: ENSMUSP00000077017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030102] [ENSMUST00000077851] [ENSMUST00000149295]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030102
AA Change: Y108N

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000030102
Gene: ENSMUSG00000028397
AA Change: Y108N

Domain	Start	End	E-Value	Type
JmjN	15	57	9.12e-14	SMART
JmjC	144	310	1.31e-61	SMART
low complexity region	361	374	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
PHD	687	745	3.3e-5	SMART
PHD	807	863	8.71e-5	SMART
TUDOR	875	932	2.96e-10	SMART
TUDOR	933	989	2e-7	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077851
AA Change: Y108N

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000077017
Gene: ENSMUSG00000028397
AA Change: Y108N

Domain	Start	End	E-Value	Type
JmjN	15	57	9.12e-14	SMART
JmjC	144	310	1.31e-61	SMART
low complexity region	361	374	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
PHD	687	745	3.3e-5	SMART
PHD	807	863	8.71e-5	SMART
TUDOR	875	932	2.96e-10	SMART
TUDOR	933	989	2e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149295

SMART Domains

Protein: ENSMUSP00000118728
Gene: ENSMUSG00000028397

Domain	Start	End	E-Value	Type
Pfam:JmjN	17	49	9.4e-14	PFAM
low complexity region	102	115	N/A	INTRINSIC
low complexity region	127	141	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156065

Meta Mutation Damage Score

0.5234

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Jumonji domain 2 (JMJD2) family. The encoded protein is a trimethylation-specific demethylase, and converts specific trimethylated histone residues to the dimethylated form. This enzymatic action regulates gene expression and chromosome segregation. Chromosomal aberrations and changes in expression of this gene may be found in tumor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null gene trap allele cannot be produced likely due to embryonic lethality. Mice heterozygous for a null gene trap allele exhibit reduced body weight and lower incidence and multiplicity of both benign and malignant tumors in mice treated with DMBA and TPA. [provided by MGI curators]

Allele List at MGI

All alleles(402) : Targeted, other(2) Gene trapped(400)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
2310022A10Rik	A	G	7: 27,565,684	N87S	probably benign	Het
5330417C22Rik	G	T	3: 108,460,943	Q885K	probably benign	Het
Apmap	A	G	2: 150,584,067	V387A	probably benign	Het
B130024G19Rik	C	T	7: 70,388,706		noncoding transcript	Het
Cd200r1	A	G	16: 44,792,764	I244M	probably damaging	Het
Clic6	T	C	16: 92,497,061		probably benign	Het
Col11a1	A	G	3: 114,208,214	D429G	probably damaging	Het
Dsg4	T	A	18: 20,458,579	Y458*	probably null	Het
Fbxl13	A	G	5: 21,543,788	Y378H	probably benign	Het
Ifi203	A	C	1: 173,933,775		probably benign	Het
Ifna6	T	C	4: 88,827,801	V129A	probably benign	Het
Igkv3-4	G	A	6: 70,672,340	A108T	probably damaging	Het
Itga1	G	A	13: 115,030,886	Q165*	probably null	Het
Lap3	T	C	5: 45,509,491	S412P	probably benign	Het
Lrfn5	G	A	12: 61,843,382	V486I	probably damaging	Het
Mep1b	A	T	18: 21,095,106		probably null	Het
Mettl6	T	C	14: 31,493,667	N52S	probably damaging	Het
Nup54	A	G	5: 92,417,484	I458T	possibly damaging	Het
Olfr1	A	C	11: 73,395,539	L161R	probably damaging	Het
Olfr773	G	A	10: 129,186,584	A279V	probably benign	Het
Pecr	A	T	1: 72,276,269	N107K	probably damaging	Het
Pnpla6	A	G	8: 3,543,997	Q1307R	probably benign	Het
Poll	T	C	19: 45,556,053	K310E	probably damaging	Het
Rab29	A	G	1: 131,867,737	Q29R	probably benign	Het
Reg2	G	A	6: 78,406,591	G99D	probably damaging	Het
Rftn2	G	A	1: 55,214,270	S58L	probably damaging	Het
Rps6kb1	T	C	11: 86,544,579	E43G	possibly damaging	Het
Sdk2	T	C	11: 113,866,989		probably null	Het
Slc38a6	T	A	12: 73,350,552	Y323N	probably benign	Het
Sp100	T	C	1: 85,706,841	S152P	probably benign	Het
Tmc5	A	G	7: 118,649,587	Y605C	probably damaging	Het
Txndc17	T	C	11: 72,207,711	Y30H	probably damaging	Het
Vmn1r44	T	A	6: 89,894,014	F247L	probably damaging	Het
Zbtb39	C	T	10: 127,742,367	T270I	possibly damaging	Het
Zfp512b	G	A	2: 181,590,598		probably null	Het
Zwilch	T	A	9: 64,158,715	R255*	probably null	Het

Other mutations in Kdm4c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Kdm4c	APN	4	74345501	missense	probably benign	0.19
IGL00225:Kdm4c	APN	4	74345567	missense	probably benign	0.03
IGL00672:Kdm4c	APN	4	74343514	missense	probably benign	0.00
IGL00897:Kdm4c	APN	4	74373684	missense	probably damaging	1.00
IGL01479:Kdm4c	APN	4	74343501	missense	probably benign	0.18
IGL01707:Kdm4c	APN	4	74336927	missense	probably damaging	1.00
IGL02142:Kdm4c	APN	4	74307016	critical splice donor site	probably null
IGL02268:Kdm4c	APN	4	74373716	missense	possibly damaging	0.94
IGL02662:Kdm4c	APN	4	74404821	missense	probably damaging	0.99
IGL03377:Kdm4c	APN	4	74271255	missense	possibly damaging	0.82
3-1:Kdm4c	UTSW	4	74334673	missense	probably benign	0.00
PIT4434001:Kdm4c	UTSW	4	74271332	missense	probably benign	0.01
R0096:Kdm4c	UTSW	4	74357343	missense	probably damaging	1.00
R0096:Kdm4c	UTSW	4	74357343	missense	probably damaging	1.00
R0219:Kdm4c	UTSW	4	74373620	missense	probably damaging	1.00
R0309:Kdm4c	UTSW	4	74345567	missense	probably benign	0.00
R0512:Kdm4c	UTSW	4	74333794	missense	probably benign
R1070:Kdm4c	UTSW	4	74373628	nonsense	probably null
R1518:Kdm4c	UTSW	4	74333826	missense	probably benign
R1713:Kdm4c	UTSW	4	74298484	missense	probably benign	0.10
R1769:Kdm4c	UTSW	4	74280997	missense	possibly damaging	0.66
R1927:Kdm4c	UTSW	4	74345483	missense	probably benign	0.00
R1962:Kdm4c	UTSW	4	74307016	intron	probably benign
R1992:Kdm4c	UTSW	4	74343394	missense	possibly damaging	0.71
R2389:Kdm4c	UTSW	4	74333870	critical splice donor site	probably null
R2979:Kdm4c	UTSW	4	74373728	nonsense	probably null
R3966:Kdm4c	UTSW	4	74298583	missense	probably damaging	1.00
R4094:Kdm4c	UTSW	4	74311678	missense	probably benign
R4543:Kdm4c	UTSW	4	74330760	missense	probably benign	0.01
R4581:Kdm4c	UTSW	4	74357339	splice site	probably null
R5019:Kdm4c	UTSW	4	74343535	missense	probably damaging	1.00
R5088:Kdm4c	UTSW	4	74334699	missense	probably benign
R5533:Kdm4c	UTSW	4	74315649	intron	probably benign
R5663:Kdm4c	UTSW	4	74399348	missense	probably damaging	1.00
R5691:Kdm4c	UTSW	4	74334728	missense	probably benign
R5775:Kdm4c	UTSW	4	74359431	missense	probably damaging	1.00
R5786:Kdm4c	UTSW	4	74359485	missense	probably damaging	0.98
R6002:Kdm4c	UTSW	4	74404969	missense	possibly damaging	0.95
R6375:Kdm4c	UTSW	4	74330715	missense	probably damaging	0.96
R6491:Kdm4c	UTSW	4	74373636	missense	probably damaging	1.00
R6790:Kdm4c	UTSW	4	74391461	missense	probably damaging	1.00
R6952:Kdm4c	UTSW	4	74357350	missense	probably damaging	1.00
R7157:Kdm4c	UTSW	4	74345567	missense	probably benign	0.01
R7319:Kdm4c	UTSW	4	74336963	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCCCTACTGATAAGGAACATAAGA -3'
(R):5'- TGTCACAGTTGTAGCATGTCA -3'

Sequencing Primer
(F):5'- CTCTGATACCACATGAGTGTA -3'
(R):5'- GCTCCATAAATAGGTGCCA -3'

Posted On

2016-02-04