Incidental Mutation 'R4171:Clic6'
ID368396
Institutional Source Beutler Lab
Gene Symbol Clic6
Ensembl Gene ENSMUSG00000022949
Gene Namechloride intracellular channel 6
SynonymsCLIC1L, 5730466J16Rik
MMRRC Submission 041011-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R4171 (G1)
Quality Score61
Status Validated
Chromosome16
Chromosomal Location92485736-92541243 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 92497061 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023670] [ENSMUST00000162181]
Predicted Effect probably benign
Transcript: ENSMUST00000023670
SMART Domains Protein: ENSMUSP00000023670
Gene: ENSMUSG00000022949

DomainStartEndE-ValueType
low complexity region 38 46 N/A INTRINSIC
low complexity region 62 74 N/A INTRINSIC
low complexity region 83 108 N/A INTRINSIC
low complexity region 151 169 N/A INTRINSIC
low complexity region 193 213 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
low complexity region 308 318 N/A INTRINSIC
Pfam:GST_N_3 375 447 2e-9 PFAM
Pfam:GST_C_2 478 567 1.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160494
SMART Domains Protein: ENSMUSP00000123968
Gene: ENSMUSG00000051297

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162181
SMART Domains Protein: ENSMUSP00000124498
Gene: ENSMUSG00000022949

DomainStartEndE-ValueType
Pfam:GST_N_3 34 100 2.8e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chloride intracellular channel family of proteins. The gene is part of a large triplicated region found on chromosomes 1, 6, and 21. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2310022A10Rik A G 7: 27,565,684 N87S probably benign Het
5330417C22Rik G T 3: 108,460,943 Q885K probably benign Het
Apmap A G 2: 150,584,067 V387A probably benign Het
B130024G19Rik C T 7: 70,388,706 noncoding transcript Het
Cd200r1 A G 16: 44,792,764 I244M probably damaging Het
Col11a1 A G 3: 114,208,214 D429G probably damaging Het
Dsg4 T A 18: 20,458,579 Y458* probably null Het
Fbxl13 A G 5: 21,543,788 Y378H probably benign Het
Ifi203 A C 1: 173,933,775 probably benign Het
Ifna6 T C 4: 88,827,801 V129A probably benign Het
Igkv3-4 G A 6: 70,672,340 A108T probably damaging Het
Itga1 G A 13: 115,030,886 Q165* probably null Het
Kdm4c T A 4: 74,280,898 Y108N possibly damaging Het
Lap3 T C 5: 45,509,491 S412P probably benign Het
Lrfn5 G A 12: 61,843,382 V486I probably damaging Het
Mep1b A T 18: 21,095,106 probably null Het
Mettl6 T C 14: 31,493,667 N52S probably damaging Het
Nup54 A G 5: 92,417,484 I458T possibly damaging Het
Olfr1 A C 11: 73,395,539 L161R probably damaging Het
Olfr773 G A 10: 129,186,584 A279V probably benign Het
Pecr A T 1: 72,276,269 N107K probably damaging Het
Pnpla6 A G 8: 3,543,997 Q1307R probably benign Het
Poll T C 19: 45,556,053 K310E probably damaging Het
Rab29 A G 1: 131,867,737 Q29R probably benign Het
Reg2 G A 6: 78,406,591 G99D probably damaging Het
Rftn2 G A 1: 55,214,270 S58L probably damaging Het
Rps6kb1 T C 11: 86,544,579 E43G possibly damaging Het
Sdk2 T C 11: 113,866,989 probably null Het
Slc38a6 T A 12: 73,350,552 Y323N probably benign Het
Sp100 T C 1: 85,706,841 S152P probably benign Het
Tmc5 A G 7: 118,649,587 Y605C probably damaging Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Vmn1r44 T A 6: 89,894,014 F247L probably damaging Het
Zbtb39 C T 10: 127,742,367 T270I possibly damaging Het
Zfp512b G A 2: 181,590,598 probably null Het
Zwilch T A 9: 64,158,715 R255* probably null Het
Other mutations in Clic6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Clic6 APN 16 92499308 missense probably damaging 0.99
IGL02104:Clic6 APN 16 92498479 missense possibly damaging 0.72
IGL02387:Clic6 APN 16 92529919 missense probably damaging 1.00
IGL02437:Clic6 APN 16 92530929 missense probably damaging 1.00
IGL02617:Clic6 APN 16 92499318 missense probably benign 0.00
unsweetened UTSW 16 92530809 missense possibly damaging 0.79
R1544:Clic6 UTSW 16 92492073 intron probably benign
R1677:Clic6 UTSW 16 92528084 missense probably damaging 1.00
R2149:Clic6 UTSW 16 92499207 missense probably benign 0.00
R3965:Clic6 UTSW 16 92498844 missense probably benign 0.00
R4545:Clic6 UTSW 16 92492157 intron probably benign
R4637:Clic6 UTSW 16 92497061 intron probably benign
R4649:Clic6 UTSW 16 92530939 critical splice donor site probably null
R5159:Clic6 UTSW 16 92528066 missense probably benign 0.13
R5249:Clic6 UTSW 16 92539451 missense probably damaging 1.00
R5486:Clic6 UTSW 16 92529852 intron probably null
R5582:Clic6 UTSW 16 92499454 missense possibly damaging 0.93
R6140:Clic6 UTSW 16 92539492 missense probably damaging 1.00
R6234:Clic6 UTSW 16 92499222 missense probably benign
R6379:Clic6 UTSW 16 92539535 missense probably damaging 1.00
R6593:Clic6 UTSW 16 92528117 missense possibly damaging 0.82
R7890:Clic6 UTSW 16 92499387 missense probably benign 0.41
RF012:Clic6 UTSW 16 92530809 missense possibly damaging 0.79
X0058:Clic6 UTSW 16 92498707 missense probably benign
Z1176:Clic6 UTSW 16 92498895 missense probably benign 0.26
Z1177:Clic6 UTSW 16 92499139 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CCATCATTCTTAGGCAACGC -3'
(R):5'- TAACTGGGCCAGGAGTCCC -3'

Sequencing Primer
(F):5'- CCAGCATTTTATCGAGACGTGACG -3'
(R):5'- AACTGTGAGGCCAGCATTTC -3'
Posted On2016-02-04