Incidental Mutation 'R4298:Sh3gl1'
ID368400
Institutional Source Beutler Lab
Gene Symbol Sh3gl1
Ensembl Gene ENSMUSG00000003200
Gene NameSH3-domain GRB2-like 1
SynonymsSh3d2b, SH3P8, endophilin II, EEN
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56016753-56036637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56019173 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 111 (G111D)
Ref Sequence ENSEMBL: ENSMUSP00000003268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003268] [ENSMUST00000149441] [ENSMUST00000159996] [ENSMUST00000162883]
Predicted Effect probably damaging
Transcript: ENSMUST00000003268
AA Change: G111D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003268
Gene: ENSMUSG00000003200
AA Change: G111D

DomainStartEndE-ValueType
BAR 5 242 1.05e-98 SMART
low complexity region 250 264 N/A INTRINSIC
SH3 309 364 7.62e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131218
Predicted Effect probably benign
Transcript: ENSMUST00000149441
SMART Domains Protein: ENSMUSP00000119745
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
JAB_MPN 260 382 1.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153197
SMART Domains Protein: ENSMUSP00000125535
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Pfam:JAB 112 243 6.1e-11 PFAM
Pfam:Prok-JAB 125 258 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159340
SMART Domains Protein: ENSMUSP00000125555
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 29 68 N/A INTRINSIC
low complexity region 169 182 N/A INTRINSIC
Blast:JAB_MPN 257 350 3e-55 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159420
Predicted Effect probably benign
Transcript: ENSMUST00000159996
SMART Domains Protein: ENSMUSP00000124644
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
JAB_MPN 260 382 1.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162883
SMART Domains Protein: ENSMUSP00000124128
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
Pfam:Prok-JAB 230 340 1.6e-8 PFAM
Pfam:JAB 236 311 1.7e-9 PFAM
Meta Mutation Damage Score 0.9270 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the endophilin family of Src homology 3 domain-containing proteins. The encoded protein is involved in endocytosis and may also play a role in the cell cycle. Overexpression of this gene may play a role in leukemogenesis, and the encoded protein has been implicated in acute myeloid leukemia as a fusion partner of the myeloid-lymphoid leukemia protein. Pseudogenes of this gene are located on the long arm of chromosomes 11 and 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal life span and no obvious phenotypic defects. Mice homozygous for knock-out alleles of Sh3gl1-3 exhibit neonatal lethality, respiratory distress, absence of gastric milk, abnormal synaptic transmissionand abnormal synaptic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Sh3gl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Sh3gl1 APN 17 56019325 missense possibly damaging 0.48
IGL02721:Sh3gl1 APN 17 56017577 missense possibly damaging 0.91
feroce UTSW 17 56017617 missense possibly damaging 0.84
sauvage UTSW 17 56019038 critical splice donor site probably null
R0092:Sh3gl1 UTSW 17 56018088 missense probably benign 0.00
R0525:Sh3gl1 UTSW 17 56017873 missense probably benign 0.00
R3684:Sh3gl1 UTSW 17 56018953 missense possibly damaging 0.91
R3792:Sh3gl1 UTSW 17 56018949 missense probably damaging 1.00
R4282:Sh3gl1 UTSW 17 56036456 missense probably damaging 1.00
R5868:Sh3gl1 UTSW 17 56019119 missense probably damaging 1.00
R6304:Sh3gl1 UTSW 17 56036431 missense probably benign 0.01
R6379:Sh3gl1 UTSW 17 56019143 missense probably damaging 1.00
R6523:Sh3gl1 UTSW 17 56017617 missense possibly damaging 0.84
R7146:Sh3gl1 UTSW 17 56017646 missense probably damaging 1.00
R7174:Sh3gl1 UTSW 17 56017846 missense probably benign 0.01
R7922:Sh3gl1 UTSW 17 56019438 missense probably damaging 1.00
R8248:Sh3gl1 UTSW 17 56019038 critical splice donor site probably null
R8429:Sh3gl1 UTSW 17 56018821 missense possibly damaging 0.94
R8460:Sh3gl1 UTSW 17 56019321 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CCAATTTCTTCAGGTGGTGC -3'
(R):5'- CCATGGCAAGGAACTAGGTG -3'

Sequencing Primer
(F):5'- TACAGCTGCGTAAGGGCAC -3'
(R):5'- GGAGAGTCCAACTTCGGTG -3'
Posted On2016-02-04