Incidental Mutation 'R4790:Kcnt2'
ID 368408
Institutional Source Beutler Lab
Gene Symbol Kcnt2
Ensembl Gene ENSMUSG00000052726
Gene Name potassium channel, subfamily T, member 2
Synonyms E330038N15Rik
MMRRC Submission 042418-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R4790 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 140173896-140539805 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 140282254 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 80 (R80C)
Ref Sequence ENSEMBL: ENSMUSP00000112887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]
AlphaFold D3Z649
Predicted Effect probably damaging
Transcript: ENSMUST00000119786
AA Change: R80C

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: R80C

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.6e-15 PFAM
Pfam:BK_channel_a 422 476 2.3e-16 PFAM
low complexity region 598 613 N/A INTRINSIC
low complexity region 620 632 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120709
AA Change: R80C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: R80C

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.7e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
low complexity region 749 764 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120796
AA Change: R80C

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: R80C

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.8e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,202,236 (GRCm39) T390P possibly damaging Het
Acss3 A T 10: 106,859,563 (GRCm39) Y345* probably null Het
Adam26b A T 8: 43,973,764 (GRCm39) S413T probably benign Het
Angpt2 T A 8: 18,764,098 (GRCm39) Q148L probably damaging Het
Ank3 T A 10: 69,823,981 (GRCm39) Y883* probably null Het
Ankrd52 A G 10: 128,216,814 (GRCm39) K190E possibly damaging Het
Anks1b A G 10: 89,999,137 (GRCm39) R415G probably damaging Het
Ano3 T A 2: 110,715,264 (GRCm39) Q58L probably benign Het
Aoc1l2 T A 6: 48,907,486 (GRCm39) I162N probably damaging Het
Arhgap39 A T 15: 76,610,931 (GRCm39) M924K possibly damaging Het
AU040320 A G 4: 126,741,008 (GRCm39) M910V possibly damaging Het
BC051019 T A 7: 109,315,553 (GRCm39) H86L probably benign Het
C1qbp G A 11: 70,870,856 (GRCm39) Q151* probably null Het
C4b G T 17: 34,953,117 (GRCm39) D1069E probably benign Het
Casp1 C T 9: 5,303,020 (GRCm39) T158I probably benign Het
Casq1 T C 1: 172,044,404 (GRCm39) D141G probably damaging Het
Ccdc33 T A 9: 57,937,240 (GRCm39) E653V probably damaging Het
Cd180 C T 13: 102,839,330 (GRCm39) T71M probably damaging Het
Cdk4 T C 10: 126,900,570 (GRCm39) L112P probably damaging Het
Celf2 A G 2: 6,554,714 (GRCm39) F425S probably damaging Het
Chrm3 A T 13: 9,927,698 (GRCm39) V446E probably benign Het
Chst9 A T 18: 15,586,107 (GRCm39) L152H probably damaging Het
Cib2 A G 9: 54,457,087 (GRCm39) probably null Het
Clec18a T C 8: 111,798,717 (GRCm39) S366G probably damaging Het
Crebbp A G 16: 3,997,983 (GRCm39) F34L probably damaging Het
Dapk1 AT A 13: 60,870,919 (GRCm39) probably null Het
Ddi1 T A 9: 6,265,761 (GRCm39) M203L probably benign Het
Ddx20 G T 3: 105,590,485 (GRCm39) S270R probably benign Het
Eddm13 A T 7: 6,269,317 (GRCm39) K31* probably null Het
Espnl A T 1: 91,272,146 (GRCm39) E458V probably damaging Het
Fat3 T C 9: 15,909,780 (GRCm39) D2074G probably damaging Het
Fcf1 A G 12: 85,020,902 (GRCm39) T61A probably benign Het
Fkbp15 T C 4: 62,226,234 (GRCm39) R772G probably benign Het
Flnb T C 14: 7,905,661 (GRCm38) V1137A probably benign Het
Fosb C A 7: 19,043,313 (GRCm39) C15F probably damaging Het
Frem2 A T 3: 53,424,162 (GRCm39) W3092R probably benign Het
Gm3248 T C 14: 5,945,831 (GRCm38) I28V probably damaging Het
Gm4922 G T 10: 18,659,916 (GRCm39) L269I possibly damaging Het
Gucy2e G A 11: 69,119,274 (GRCm39) R627W probably damaging Het
Hephl1 T A 9: 14,970,467 (GRCm39) E1009V probably damaging Het
Hsf4 A T 8: 105,997,237 (GRCm39) Q61L probably damaging Het
Itgam T A 7: 127,715,445 (GRCm39) N1046K probably benign Het
Itgav G A 2: 83,586,154 (GRCm39) C138Y probably damaging Het
Itih4 A T 14: 30,611,867 (GRCm39) Y157F probably damaging Het
Kdm4b G A 17: 56,708,618 (GRCm39) V986M probably damaging Het
Lamb3 T A 1: 193,022,194 (GRCm39) V1014D probably damaging Het
Lrrc74b G T 16: 17,367,717 (GRCm39) N282K probably damaging Het
Map3k20 T A 2: 72,272,048 (GRCm39) H725Q probably benign Het
Mink1 A G 11: 70,489,867 (GRCm39) N81S probably damaging Het
Mmp21 A G 7: 133,276,759 (GRCm39) Y415H probably damaging Het
Mycbp2 A T 14: 103,466,873 (GRCm39) W1297R probably damaging Het
Myh8 T C 11: 67,170,789 (GRCm39) M95T probably damaging Het
Myo7b A T 18: 32,133,158 (GRCm39) probably null Het
Nanog A G 6: 122,684,874 (GRCm39) M20V probably benign Het
Ncapd3 A G 9: 26,963,146 (GRCm39) I484V probably benign Het
Ndufa12 A T 10: 94,056,620 (GRCm39) N116I probably benign Het
Nedd4l A G 18: 65,337,016 (GRCm39) I668V possibly damaging Het
Nhsl3 C A 4: 129,117,095 (GRCm39) R523L probably damaging Het
Nobox T C 6: 43,282,480 (GRCm39) D309G probably benign Het
Npnt A G 3: 132,596,523 (GRCm39) probably benign Het
Nrxn1 A C 17: 90,762,477 (GRCm39) Y2D possibly damaging Het
Obox6 G T 7: 15,568,502 (GRCm39) P125T possibly damaging Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or14j8 T C 17: 38,263,633 (GRCm39) Y94C probably damaging Het
Or2ag15 C G 7: 106,340,998 (GRCm39) V48L probably benign Het
Or4s2b T A 2: 88,508,731 (GRCm39) N177K possibly damaging Het
Or56a3 T C 7: 104,735,844 (GRCm39) probably benign Het
Or5ac20 A T 16: 59,104,821 (GRCm39) V13D probably damaging Het
Or5an10 A G 19: 12,276,305 (GRCm39) Y64H possibly damaging Het
Or8k32 T C 2: 86,369,224 (GRCm39) T10A possibly damaging Het
Osm A T 11: 4,188,435 (GRCm39) M21L probably benign Het
Otogl T A 10: 107,657,894 (GRCm39) probably null Het
Otud4 T G 8: 80,393,402 (GRCm39) S493A possibly damaging Het
Pars2 A G 4: 106,508,308 (GRCm39) probably benign Het
Phlda3 T A 1: 135,694,557 (GRCm39) V124E possibly damaging Het
Pias4 T C 10: 80,993,326 (GRCm39) D199G probably damaging Het
Pm20d1 T C 1: 131,739,777 (GRCm39) L375P probably benign Het
Pole2 T C 12: 69,273,139 (GRCm39) I48V probably benign Het
Prrc2c T C 1: 162,538,050 (GRCm39) R527G unknown Het
Rasgrf2 G T 13: 92,136,135 (GRCm39) N592K probably damaging Het
Rbm7 A G 9: 48,406,474 (GRCm39) L26P probably damaging Het
Rhag A G 17: 41,142,181 (GRCm39) H208R probably benign Het
Rnf17 A G 14: 56,671,812 (GRCm39) E268G probably damaging Het
Rnf220 A G 4: 117,146,252 (GRCm39) V23A probably benign Het
Rnf7 A T 9: 96,360,472 (GRCm39) V55D probably damaging Het
Sdr9c7 C A 10: 127,739,448 (GRCm39) R188S possibly damaging Het
Senp6 T A 9: 79,997,140 (GRCm39) N51K probably benign Het
Skint3 C A 4: 112,113,095 (GRCm39) T235K possibly damaging Het
Slc10a5 A G 3: 10,400,096 (GRCm39) F188S probably damaging Het
Slc41a1 G A 1: 131,758,690 (GRCm39) G111R probably damaging Het
Smarca1 T C X: 46,972,944 (GRCm39) D132G probably null Het
Snrnp48 C T 13: 38,405,299 (GRCm39) R299W probably damaging Het
Sspo G A 6: 48,437,705 (GRCm39) G1413D probably benign Het
Star T A 8: 26,298,644 (GRCm39) H16Q probably damaging Het
Strc T C 2: 121,206,075 (GRCm39) D779G probably benign Het
Sulf2 T C 2: 165,931,215 (GRCm39) Y264C probably damaging Het
Supt7l A G 5: 31,680,248 (GRCm39) S6P possibly damaging Het
Syne2 A G 12: 76,067,165 (GRCm39) D4289G probably benign Het
Szrd1 A T 4: 140,867,001 (GRCm39) probably null Het
Tada1 T C 1: 166,219,523 (GRCm39) V275A possibly damaging Het
Tbr1 A T 2: 61,641,932 (GRCm39) Y136F probably benign Het
Tbx20 T A 9: 24,637,010 (GRCm39) H359L probably benign Het
Thbs4 G T 13: 92,899,314 (GRCm39) D560E probably damaging Het
Tnfsf14 T C 17: 57,497,740 (GRCm39) H164R probably damaging Het
Trmu T C 15: 85,767,006 (GRCm39) S72P probably damaging Het
Tsnaxip1 C A 8: 106,560,155 (GRCm39) Q36K probably benign Het
Ttc28 T A 5: 111,372,083 (GRCm39) M844K possibly damaging Het
Tubgcp2 T C 7: 139,579,201 (GRCm39) Y695C probably damaging Het
Ugt1a10 T A 1: 87,984,009 (GRCm39) M269K probably damaging Het
Urb1 A T 16: 90,566,443 (GRCm39) L1448* probably null Het
Vmn2r124 A T 17: 18,269,855 (GRCm39) H37L probably damaging Het
Vmn2r44 T C 7: 8,370,949 (GRCm39) N699S probably damaging Het
Vps35 A T 8: 86,005,486 (GRCm39) probably null Het
Yipf1 G T 4: 107,193,396 (GRCm39) probably null Het
Zfp395 A G 14: 65,623,990 (GRCm39) N153S possibly damaging Het
Zfp395 A G 14: 65,630,656 (GRCm39) D402G probably damaging Het
Zfp652 T C 11: 95,640,435 (GRCm39) V120A probably damaging Het
Zp3r T C 1: 130,510,629 (GRCm39) I364M probably damaging Het
Other mutations in Kcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Kcnt2 APN 1 140,450,836 (GRCm39) missense probably damaging 1.00
IGL00673:Kcnt2 APN 1 140,523,789 (GRCm39) missense possibly damaging 0.60
IGL00806:Kcnt2 APN 1 140,450,949 (GRCm39) missense probably damaging 1.00
IGL01135:Kcnt2 APN 1 140,282,293 (GRCm39) critical splice donor site probably null 0.00
IGL01412:Kcnt2 APN 1 140,498,155 (GRCm39) missense probably benign 0.02
IGL01777:Kcnt2 APN 1 140,523,736 (GRCm39) missense probably benign 0.20
IGL01780:Kcnt2 APN 1 140,279,007 (GRCm39) missense probably benign 0.09
IGL02134:Kcnt2 APN 1 140,304,121 (GRCm39) missense probably benign
IGL02350:Kcnt2 APN 1 140,279,007 (GRCm39) missense probably benign 0.09
IGL02357:Kcnt2 APN 1 140,279,007 (GRCm39) missense probably benign 0.09
IGL02481:Kcnt2 APN 1 140,282,299 (GRCm39) splice site probably benign
IGL02483:Kcnt2 APN 1 140,282,299 (GRCm39) splice site probably benign
IGL02866:Kcnt2 APN 1 140,352,986 (GRCm39) missense probably damaging 1.00
IGL02891:Kcnt2 APN 1 140,502,544 (GRCm39) missense probably damaging 1.00
IGL03007:Kcnt2 APN 1 140,282,245 (GRCm39) missense possibly damaging 0.50
IGL03024:Kcnt2 APN 1 140,498,193 (GRCm39) missense probably benign 0.00
IGL03231:Kcnt2 APN 1 140,461,740 (GRCm39) intron probably benign
BB002:Kcnt2 UTSW 1 140,282,247 (GRCm39) nonsense probably null
BB012:Kcnt2 UTSW 1 140,282,247 (GRCm39) nonsense probably null
R0230:Kcnt2 UTSW 1 140,174,083 (GRCm39) missense probably benign 0.00
R0367:Kcnt2 UTSW 1 140,278,963 (GRCm39) missense probably damaging 1.00
R0486:Kcnt2 UTSW 1 140,437,218 (GRCm39) nonsense probably null
R0543:Kcnt2 UTSW 1 140,537,352 (GRCm39) missense probably damaging 1.00
R0849:Kcnt2 UTSW 1 140,435,500 (GRCm39) missense probably damaging 1.00
R1123:Kcnt2 UTSW 1 140,501,346 (GRCm39) missense probably damaging 1.00
R1156:Kcnt2 UTSW 1 140,356,593 (GRCm39) missense probably damaging 1.00
R1425:Kcnt2 UTSW 1 140,310,766 (GRCm39) missense probably damaging 1.00
R1530:Kcnt2 UTSW 1 140,411,970 (GRCm39) nonsense probably null
R1546:Kcnt2 UTSW 1 140,359,116 (GRCm39) missense probably benign 0.01
R1728:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1729:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1730:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1739:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1762:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1783:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1784:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1785:Kcnt2 UTSW 1 140,282,285 (GRCm39) missense probably benign 0.00
R1862:Kcnt2 UTSW 1 140,353,068 (GRCm39) missense probably damaging 1.00
R1887:Kcnt2 UTSW 1 140,511,985 (GRCm39) missense probably damaging 0.99
R1889:Kcnt2 UTSW 1 140,512,031 (GRCm39) missense probably damaging 1.00
R1894:Kcnt2 UTSW 1 140,353,079 (GRCm39) missense probably damaging 1.00
R2005:Kcnt2 UTSW 1 140,480,756 (GRCm39) missense probably damaging 0.98
R2044:Kcnt2 UTSW 1 140,302,892 (GRCm39) missense probably benign 0.14
R2115:Kcnt2 UTSW 1 140,480,701 (GRCm39) missense probably damaging 1.00
R2135:Kcnt2 UTSW 1 140,356,551 (GRCm39) missense probably damaging 1.00
R2201:Kcnt2 UTSW 1 140,437,179 (GRCm39) missense probably damaging 1.00
R2212:Kcnt2 UTSW 1 140,458,538 (GRCm39) missense probably damaging 1.00
R2267:Kcnt2 UTSW 1 140,501,421 (GRCm39) splice site probably null
R2442:Kcnt2 UTSW 1 140,304,091 (GRCm39) missense possibly damaging 0.59
R3121:Kcnt2 UTSW 1 140,356,622 (GRCm39) missense probably damaging 0.97
R3176:Kcnt2 UTSW 1 140,537,377 (GRCm39) missense probably benign 0.16
R3276:Kcnt2 UTSW 1 140,537,377 (GRCm39) missense probably benign 0.16
R3704:Kcnt2 UTSW 1 140,461,706 (GRCm39) missense probably damaging 1.00
R3944:Kcnt2 UTSW 1 140,512,025 (GRCm39) missense probably damaging 1.00
R4164:Kcnt2 UTSW 1 140,537,368 (GRCm39) missense probably damaging 0.97
R4201:Kcnt2 UTSW 1 140,353,070 (GRCm39) missense probably damaging 0.98
R4501:Kcnt2 UTSW 1 140,480,718 (GRCm39) missense probably damaging 0.99
R4502:Kcnt2 UTSW 1 140,435,485 (GRCm39) missense probably damaging 0.99
R4632:Kcnt2 UTSW 1 140,450,886 (GRCm39) missense possibly damaging 0.90
R4758:Kcnt2 UTSW 1 140,446,635 (GRCm39) missense probably damaging 1.00
R4892:Kcnt2 UTSW 1 140,440,763 (GRCm39) nonsense probably null
R4973:Kcnt2 UTSW 1 140,537,388 (GRCm39) missense probably damaging 1.00
R5154:Kcnt2 UTSW 1 140,278,994 (GRCm39) missense possibly damaging 0.94
R5296:Kcnt2 UTSW 1 140,537,353 (GRCm39) missense probably damaging 1.00
R5353:Kcnt2 UTSW 1 140,354,639 (GRCm39) missense probably damaging 1.00
R5605:Kcnt2 UTSW 1 140,502,481 (GRCm39) missense possibly damaging 0.59
R5806:Kcnt2 UTSW 1 140,437,234 (GRCm39) missense probably damaging 1.00
R5887:Kcnt2 UTSW 1 140,353,104 (GRCm39) missense probably damaging 1.00
R5917:Kcnt2 UTSW 1 140,461,666 (GRCm39) missense probably damaging 0.99
R5961:Kcnt2 UTSW 1 140,435,440 (GRCm39) missense possibly damaging 0.82
R6123:Kcnt2 UTSW 1 140,290,718 (GRCm39) missense probably damaging 1.00
R6225:Kcnt2 UTSW 1 140,354,661 (GRCm39) nonsense probably null
R6248:Kcnt2 UTSW 1 140,437,216 (GRCm39) missense probably damaging 1.00
R6351:Kcnt2 UTSW 1 140,302,850 (GRCm39) missense probably damaging 1.00
R6380:Kcnt2 UTSW 1 140,437,322 (GRCm39) missense probably damaging 1.00
R6532:Kcnt2 UTSW 1 140,511,844 (GRCm39) missense probably damaging 0.97
R6693:Kcnt2 UTSW 1 140,278,965 (GRCm39) missense probably benign 0.00
R6817:Kcnt2 UTSW 1 140,173,931 (GRCm39) unclassified probably benign
R6856:Kcnt2 UTSW 1 140,523,742 (GRCm39) missense probably damaging 1.00
R6944:Kcnt2 UTSW 1 140,511,803 (GRCm39) missense probably benign 0.00
R6971:Kcnt2 UTSW 1 140,440,646 (GRCm39) missense probably benign 0.01
R7052:Kcnt2 UTSW 1 140,310,785 (GRCm39) missense probably damaging 0.99
R7138:Kcnt2 UTSW 1 140,523,778 (GRCm39) missense possibly damaging 0.80
R7261:Kcnt2 UTSW 1 140,282,255 (GRCm39) missense possibly damaging 0.71
R7474:Kcnt2 UTSW 1 140,498,216 (GRCm39) missense possibly damaging 0.84
R7524:Kcnt2 UTSW 1 140,511,793 (GRCm39) missense probably damaging 0.99
R7541:Kcnt2 UTSW 1 140,304,122 (GRCm39) missense probably benign 0.09
R7558:Kcnt2 UTSW 1 140,450,928 (GRCm39) missense probably damaging 0.98
R7651:Kcnt2 UTSW 1 140,498,199 (GRCm39) missense probably benign 0.40
R7730:Kcnt2 UTSW 1 140,446,686 (GRCm39) missense probably benign 0.34
R7875:Kcnt2 UTSW 1 140,501,385 (GRCm39) missense probably damaging 1.00
R7883:Kcnt2 UTSW 1 140,450,888 (GRCm39) missense probably damaging 0.99
R7925:Kcnt2 UTSW 1 140,282,247 (GRCm39) nonsense probably null
R8040:Kcnt2 UTSW 1 140,377,955 (GRCm39) missense probably damaging 1.00
R8041:Kcnt2 UTSW 1 140,537,398 (GRCm39) missense probably benign
R8171:Kcnt2 UTSW 1 140,437,203 (GRCm39) missense probably benign 0.13
R8268:Kcnt2 UTSW 1 140,450,954 (GRCm39) missense probably damaging 0.99
R8905:Kcnt2 UTSW 1 140,435,467 (GRCm39) missense possibly damaging 0.65
R8927:Kcnt2 UTSW 1 140,356,535 (GRCm39) splice site probably null
R8988:Kcnt2 UTSW 1 140,356,587 (GRCm39) missense probably benign 0.38
R9020:Kcnt2 UTSW 1 140,512,049 (GRCm39) missense probably benign 0.23
R9109:Kcnt2 UTSW 1 140,353,035 (GRCm39) missense probably damaging 1.00
R9167:Kcnt2 UTSW 1 140,506,200 (GRCm39) missense probably benign 0.11
R9232:Kcnt2 UTSW 1 140,411,931 (GRCm39) missense possibly damaging 0.56
R9297:Kcnt2 UTSW 1 140,352,933 (GRCm39) missense probably damaging 0.99
R9298:Kcnt2 UTSW 1 140,353,035 (GRCm39) missense probably damaging 1.00
R9318:Kcnt2 UTSW 1 140,352,933 (GRCm39) missense probably damaging 0.99
R9404:Kcnt2 UTSW 1 140,353,107 (GRCm39) missense probably damaging 1.00
X0062:Kcnt2 UTSW 1 140,440,729 (GRCm39) missense possibly damaging 0.50
Z1088:Kcnt2 UTSW 1 140,511,896 (GRCm39) nonsense probably null
Z1088:Kcnt2 UTSW 1 140,501,384 (GRCm39) missense probably damaging 1.00
Z1176:Kcnt2 UTSW 1 140,304,099 (GRCm39) missense probably damaging 1.00
Z1177:Kcnt2 UTSW 1 140,537,386 (GRCm39) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCAGCTACCAAGAACTTCAGTAAG -3'
(R):5'- GGAGACATGAGCCCATTTTCAAC -3'

Sequencing Primer
(F):5'- CCTTCTAAGTGCTGAACTG -3'
(R):5'- TGAGCCCATTTTCAACTAATATTCAC -3'
Posted On 2016-02-04