Mutagenetix > Incidental Mutation

Incidental Mutation 'R4790:Strc'

368420

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

042418-MU

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R4790 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121375594 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 779 (D779G)

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]

AlphaFold

Q8VIM6

Predicted Effect

probably benign
Transcript: ENSMUST00000038389
AA Change: D779G

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: D779G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129136

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134443

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149219

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150332

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	T	A	6: 48,930,552	I162N	probably damaging	Het
Abca5	T	G	11: 110,311,410	T390P	possibly damaging	Het
Acss3	A	T	10: 107,023,702	Y345*	probably null	Het
Adam26b	A	T	8: 43,520,727	S413T	probably benign	Het
Angpt2	T	A	8: 18,714,082	Q148L	probably damaging	Het
Ank3	T	A	10: 69,988,151	Y883*	probably null	Het
Ankrd52	A	G	10: 128,380,945	K190E	possibly damaging	Het
Anks1b	A	G	10: 90,163,275	R415G	probably damaging	Het
Ano3	T	A	2: 110,884,919	Q58L	probably benign	Het
Arhgap39	A	T	15: 76,726,731	M924K	possibly damaging	Het
AU040320	A	G	4: 126,847,215	M910V	possibly damaging	Het
BC051019	T	A	7: 109,716,346	H86L	probably benign	Het
C1qbp	G	A	11: 70,980,030	Q151*	probably null	Het
C4b	G	T	17: 34,734,143	D1069E	probably benign	Het
C77080	C	A	4: 129,223,302	R523L	probably damaging	Het
Casp1	C	T	9: 5,303,020	T158I	probably benign	Het
Casq1	T	C	1: 172,216,837	D141G	probably damaging	Het
Ccdc33	T	A	9: 58,029,957	E653V	probably damaging	Het
Cd180	C	T	13: 102,702,822	T71M	probably damaging	Het
Cdk4	T	C	10: 127,064,701	L112P	probably damaging	Het
Celf2	A	G	2: 6,549,903	F425S	probably damaging	Het
Chrm3	A	T	13: 9,877,662	V446E	probably benign	Het
Chst9	A	T	18: 15,453,050	L152H	probably damaging	Het
Cib2	A	G	9: 54,549,803		probably null	Het
Clec18a	T	C	8: 111,072,085	S366G	probably damaging	Het
Crebbp	A	G	16: 4,180,119	F34L	probably damaging	Het
Dapk1	AT	A	13: 60,723,105		probably null	Het
Ddi1	T	A	9: 6,265,761	M203L	probably benign	Het
Ddx20	G	T	3: 105,683,169	S270R	probably benign	Het
Epp13	A	T	7: 6,266,318	K31*	probably null	Het
Espnl	A	T	1: 91,344,424	E458V	probably damaging	Het
Fat3	T	C	9: 15,998,484	D2074G	probably damaging	Het
Fcf1	A	G	12: 84,974,128	T61A	probably benign	Het
Fkbp15	T	C	4: 62,307,997	R772G	probably benign	Het
Flnb	T	C	14: 7,905,661	V1137A	probably benign	Het
Fosb	C	A	7: 19,309,388	C15F	probably damaging	Het
Frem2	A	T	3: 53,516,741	W3092R	probably benign	Het
Gm3248	T	C	14: 5,945,831	I28V	probably damaging	Het
Gm4922	G	T	10: 18,784,168	L269I	possibly damaging	Het
Gucy2e	G	A	11: 69,228,448	R627W	probably damaging	Het
Hephl1	T	A	9: 15,059,171	E1009V	probably damaging	Het
Hsf4	A	T	8: 105,270,605	Q61L	probably damaging	Het
Itgam	T	A	7: 128,116,273	N1046K	probably benign	Het
Itgav	G	A	2: 83,755,810	C138Y	probably damaging	Het
Itih4	A	T	14: 30,889,910	Y157F	probably damaging	Het
Kcnt2	C	T	1: 140,354,516	R80C	probably damaging	Het
Kdm4b	G	A	17: 56,401,618	V986M	probably damaging	Het
Lamb3	T	A	1: 193,339,886	V1014D	probably damaging	Het
Lrrc74b	G	T	16: 17,549,853	N282K	probably damaging	Het
Map3k20	T	A	2: 72,441,704	H725Q	probably benign	Het
Mink1	A	G	11: 70,599,041	N81S	probably damaging	Het
Mmp21	A	G	7: 133,675,030	Y415H	probably damaging	Het
Mycbp2	A	T	14: 103,229,437	W1297R	probably damaging	Het
Myh8	T	C	11: 67,279,963	M95T	probably damaging	Het
Myo7b	A	T	18: 32,000,105		probably null	Het
Nanog	A	G	6: 122,707,915	M20V	probably benign	Het
Ncapd3	A	G	9: 27,051,850	I484V	probably benign	Het
Ndufa12	A	T	10: 94,220,758	N116I	probably benign	Het
Nedd4l	A	G	18: 65,203,945	I668V	possibly damaging	Het
Nobox	T	C	6: 43,305,546	D309G	probably benign	Het
Npnt	A	G	3: 132,890,762		probably benign	Het
Nrxn1	A	C	17: 90,455,049	Y2D	possibly damaging	Het
Obox6	G	T	7: 15,834,577	P125T	possibly damaging	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr1079	T	C	2: 86,538,880	T10A	possibly damaging	Het
Olfr1193	T	A	2: 88,678,387	N177K	possibly damaging	Het
Olfr1436	A	G	19: 12,298,941	Y64H	possibly damaging	Het
Olfr202	A	T	16: 59,284,458	V13D	probably damaging	Het
Olfr679	T	C	7: 105,086,637		probably benign	Het
Olfr697	C	G	7: 106,741,791	V48L	probably benign	Het
Olfr761	T	C	17: 37,952,742	Y94C	probably damaging	Het
Osm	A	T	11: 4,238,435	M21L	probably benign	Het
Otogl	T	A	10: 107,822,033		probably null	Het
Otud4	T	G	8: 79,666,773	S493A	possibly damaging	Het
Pars2	A	G	4: 106,651,111		probably benign	Het
Phlda3	T	A	1: 135,766,819	V124E	possibly damaging	Het
Pias4	T	C	10: 81,157,492	D199G	probably damaging	Het
Pm20d1	T	C	1: 131,812,039	L375P	probably benign	Het
Pole2	T	C	12: 69,226,365	I48V	probably benign	Het
Prrc2c	T	C	1: 162,710,481	R527G	unknown	Het
Rasgrf2	G	T	13: 91,988,016	N592K	probably damaging	Het
Rbm7	A	G	9: 48,495,174	L26P	probably damaging	Het
Rhag	A	G	17: 40,831,290	H208R	probably benign	Het
Rnf17	A	G	14: 56,434,355	E268G	probably damaging	Het
Rnf220	A	G	4: 117,289,055	V23A	probably benign	Het
Rnf7	A	T	9: 96,478,419	V55D	probably damaging	Het
Sdr9c7	C	A	10: 127,903,579	R188S	possibly damaging	Het
Senp6	T	A	9: 80,089,858	N51K	probably benign	Het
Skint3	C	A	4: 112,255,898	T235K	possibly damaging	Het
Slc10a5	A	G	3: 10,335,036	F188S	probably damaging	Het
Slc41a1	G	A	1: 131,830,952	G111R	probably damaging	Het
Smarca1	T	C	X: 47,884,067	D132G	probably null	Het
Snrnp48	C	T	13: 38,221,323	R299W	probably damaging	Het
Sspo	G	A	6: 48,460,771	G1413D	probably benign	Het
Star	T	A	8: 25,808,616	H16Q	probably damaging	Het
Sulf2	T	C	2: 166,089,295	Y264C	probably damaging	Het
Supt7l	A	G	5: 31,522,904	S6P	possibly damaging	Het
Syne2	A	G	12: 76,020,391	D4289G	probably benign	Het
Szrd1	A	T	4: 141,139,690		probably null	Het
Tada1	T	C	1: 166,391,954	V275A	possibly damaging	Het
Tbr1	A	T	2: 61,811,588	Y136F	probably benign	Het
Tbx20	T	A	9: 24,725,714	H359L	probably benign	Het
Thbs4	G	T	13: 92,762,806	D560E	probably damaging	Het
Tnfsf14	T	C	17: 57,190,740	H164R	probably damaging	Het
Trmu	T	C	15: 85,882,805	S72P	probably damaging	Het
Tsnaxip1	C	A	8: 105,833,523	Q36K	probably benign	Het
Ttc28	T	A	5: 111,224,217	M844K	possibly damaging	Het
Tubgcp2	T	C	7: 139,999,288	Y695C	probably damaging	Het
Ugt1a10	T	A	1: 88,056,287	M269K	probably damaging	Het
Urb1	A	T	16: 90,769,555	L1448*	probably null	Het
Vmn2r124	A	T	17: 18,049,593	H37L	probably damaging	Het
Vmn2r44	T	C	7: 8,367,950	N699S	probably damaging	Het
Vps35	A	T	8: 85,278,857		probably null	Het
Yipf1	G	T	4: 107,336,199		probably null	Het
Zfp395	A	G	14: 65,386,541	N153S	possibly damaging	Het
Zfp395	A	G	14: 65,393,207	D402G	probably damaging	Het
Zfp652	T	C	11: 95,749,609	V120A	probably damaging	Het
Zp3r	T	C	1: 130,582,892	I364M	probably damaging	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121377805	missense	probably damaging	0.99
R8874:Strc	UTSW	2	121374872	critical splice donor site	probably null
R8947:Strc	UTSW	2	121370989	missense	probably benign	0.09
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121380855	missense	unknown
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121368166	missense	probably damaging	1.00
R9581:Strc	UTSW	2	121377447	missense	probably damaging	0.99
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAAATGGATGCTGCCTCCG -3'
(R):5'- TACTGTGGGATCTACTCCAGAG -3'

Sequencing Primer
(F):5'- GATGCTGCCTCCGAGTTTATTCAG -3'
(R):5'- CTACTCCAGAGAGAGAAGAGCGTTTG -3'

Posted On

2016-02-04